Saltar al contenido
Merck

EHU007531

Sigma-Aldrich

MISSION® esiRNA

targeting human CDCA5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTGAAAACGGAGCTGGATGAGTGGGCTGCGGCCATGAATGCCGAGTTTGAAGCTGCTGAGCAGTTTGATCTCCTGGTTGAATGAGATGCAGTGGGGGGTGCACCTGGCCAGACTCTCCCTCCTGTCCTGTACATAGCCACCTCCCTGTGGAGAGGACACTTAGGGTCCCCTCCCCTGGTCTTGTTACCTGTGTGTGTGCTGGTGCTGCGCATGAGGACTGTCTGCCTTTGAGGGCTTGGGCAGCAGCGGCAGCCATCTTGGTTTTAGGAAATGGGGCCGCCTGGCCCAGCCACTCACTGGTGTCCTGTCTCTTGTCGTCCTGTCCTTCCTATCTCCCCAAAGTACCATAGCCAGTTTCCAGATGGGCCACAGACTGGGGAGGAGAATCAGTGGCCCAGCCAGAAGTTAAAGGGCTGAGGGTTGAGGTGAGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianlin Wang et al.
Oncology reports, 40(4), 1875-1884 (2018-07-18)
Cell division cycle associated 5 (CDCA5) has been associated with the progression of several types of cancers. However, its possible role and mechanism in hepatocellular carcinoma (HCC) remain unknown. In the present study, immunohistochemical staining and real‑time PCR were used to
Tatsuya Kato et al.
International journal of oncology, 49(6), 2411-2420 (2016-11-15)
Malignant pleural mesothelioma (MPM) is an aggressive type of cancer of the thoracic cavity commonly associated with asbestos exposure and a high mortality rate. There is a need for new molecular targets for the development of more effective therapies for
Chun-Jie Huang et al.
In vitro cellular & developmental biology. Animal, 53(3), 258-264 (2016-11-09)
Maintenance and timely termination of cohesion on chromosomes ensures accurate chromosome segregation to guard against aneuploidy in mammalian oocytes and subsequent chromosomally abnormal pregnancies. Sororin, a cohesion stabilizer whose relevance in antagonizing the anti-cohesive property of Wings-apart like protein (Wapl)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico