Saltar al contenido
Merck

EHU007361

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGCCCGACTTGAAGGTAGAAGTTCCTTGAAAGAAATAGAACCAAATCTGTTTGCTGATGAAGATTCACCTGTGCATGGTGATATTCTTGAATTTCATGGCCCAGAAGGAACAGGAAAAACAGAAATGCTTTATCACCTAACAGCACGATGTATACTTCCCAAATCAGAAGGTGGCCTGGAAGTAGAAGTCTTATTTATTGATACAGATTACCACTTTGATATGCTCCGGCTAGTTACAATTCTTGAGCACAGACTATCCCAAAGCTCTGAAGAAATAATCAAATACTGCCTGGGAAGATTTTTTTTGGTGTACTGCAGTAGTAGCACCCACTTACTTCTTACACTTTACTCACTAGAAAGTATGTTTTGTAGTCACCCATCTCTCTGCCTTTTGATTTTGGATAGCCTGTCAGCTTTTTACTGGATAGACCGCGTCAATGGAGGAGAAAGTGTGAACTTACAGGAGTCTACTCTGAGGAAATGTTCTCAGTGCTTAGAGAAGCTTGTAAATGACTATCGCCTGGTTCTTTTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can
Zuzana Nascakova et al.
International journal of molecular sciences, 22(7) (2021-05-01)
R-loops are three-stranded structures generated by annealing of nascent transcripts to the template DNA strand, leaving the non-template DNA strand exposed as a single-stranded loop. Although R-loops play important roles in physiological processes such as regulation of gene expression, mitochondrial
Xinzhu Deng et al.
PloS one, 10(6), e0127862-e0127862 (2015-06-30)
Mammalian NOTCH1-4 receptors are all associated with human malignancy, although exact roles remain enigmatic. Here we employ glp-1(ar202), a temperature-sensitive gain-of-function C. elegans NOTCH mutant, to delineate NOTCH-driven tumor responses to radiotherapy. At ≤20°C, glp-1(ar202) is wild-type, whereas at 25°C

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico