Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU006001

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCAAATCTCCAGGAGGACTCTCTGATGAAGACCCAGGCGGAGCTGCTGCTGGAGCGTCTGCAGGAGGTGGGGAAGGCCGAAGCGGAGCGTCCCGCCAGGTTTCTCAGCAGCCTGTGGGAGCGCTTGCCTCAGAACAACTTCCTGAAGGTGATAGCGGTGGCGCTGTTGCAGCCGCCTTTGTCTCGTCGGCCCCAAGAAGAGTTGGAACCCGGCATCCACAAATCACCTGGAGAGGGGAGCCAAGTGCTAGTCCACTGGCTTCTGGGGAATTCGGAAGTCTTTGCTGCCTTTTGTCGCGCCCTCCCAGCCGGGCTTTTGACTTTAGTGACTAGCCGCCACCCAGCGCTGTCTCCTGTCTATCTGGGTCTGCTAACAGACTGGGGTCAACGTTTGCACTATGACCTTCAGAAAGGCATTTGGGTTGGAACTGAGTCC

Ensembl | human accession no.

ENSG00000183161

NCBI accession no.

NM_022725

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FANCF(2188) , FANCF(2188)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Miao He et al.
Oncology reports, 29(5), 1721-1729 (2013-02-27)
In the present study, we downregulated FANCF expression by small interfering RNA (siRNA) in OVCAR ovarian cancer cells to address the effects of decreased FANCF expression on the function of the Fanconi anemia (FA)/breast cancer susceptibility gene (BRCA) pathway. Furthermore
Yanlin Li et al.
PloS one, 7(8), e44254-e44254 (2012-09-07)
Fanconi anemia complementation group-F (FANCF) is a key factor to maintain the function of FA/BRCA, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In this study, we examined the effects and
Jiankun Yu et al.
International journal of nanomedicine, 11, 6651-6666 (2016-12-21)
Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N'-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short
Jiankun Yu et al.
Journal of breast cancer, 16(3), 291-299 (2013-10-25)
Fanconi anemia complementation group F (FANCF) is a key factor to maintaining the function of Fanconi anaemia/BRCA (FA/BRCA) pathway, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In the present study
Lin Zhao et al.
International journal of oncology, 45(1), 129-138 (2014-05-03)
The Fanconi anemia/BRCA (FA/BRCA) DNA damage repair pathway plays a pivotal role in the cellular response to DNA alkylating agents and greatly influences drug response in cancer treatment. However, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico