Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU003861

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCAT

Ensembl | nº de acceso humano

ENSG00000124762

Nº de acceso NCBI

NM_000389
NM_078467

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CDKN1A(1026) , CDKN1A(1026)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XPU
TNU
YBU
NZT
OAT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Ji et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 895-907 (2016-12-13)
The Notch signaling pathway has been implicated in the pericyte phenotype, but its exact roles in hemangioma-derived pericytes (Hem-pericytes) remain ill defined. Hem-pericytes were stimulated by immobilized recombinant Jagged1. The potential mechanisms of Notch-induced Hem-pericytes growth arrest were investigated by
Mugdha Patki et al.
Scientific reports, 8(1), 16006-16006 (2018-10-31)
Dexamethasone (Dex), co-administered to lung adenocarcinoma patients with pemetrexed chemotherapy, protects against pemetrexed cytotoxicity by inducing reversible G1 arrest, reflected by the effect of Dex on FLT-PET images of patient tumors. However, perioperative Dex treatment increases survival but the mechanism
Hui Zhu et al.
Stem cells (Dayton, Ohio), 32(8), 2098-2110 (2014-04-18)
In mammalian embryos, embryonic stem cells (ESCs) and induced pluripotent cells, a shortened G1 phase is correlated with the pluripotent state. To molecularly define this phase, we compared transcripts from the shortened G1 of human ESCs (hESCs) with those from
Anna E Vilgelm et al.
EBioMedicine, 24, 43-55 (2017-10-17)
Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA
Hang Thi Thuy Bui et al.
International journal of medical sciences, 16(11), 1412-1423 (2019-11-02)
Resistance against tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced cell death of cancer cells is a major obstacle in clinical application of TRAIL. Variable response to TRAIL of gastric cancer cells, synergy of TRAIL with bortezomib and potential mechanisms behind the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico