Skip to Content
Merck
All Photos(1)

Key Documents

PROT20

Millipore

ProteoPrep® 20 Plasma Immunodepletion Kit

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$211.00
50 μG
$377.00

$211.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$211.00
50 μG
$377.00

About This Item

UNSPSC Code:
12352200

$211.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

shipped in

wet ice

storage temp.

2-8°C

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU903961EMU147591EHU031881
esiRNA cDNA target sequence

CACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGG

esiRNA cDNA target sequence

GCGTGCGCACCTTCCTGTCCTAGGCCAGGTGCCATGGCCGGCCAGGTGGGCTGCAGAGTGGGCTCCCTGCCCCTCTCTGCCTGTTCTGGACTGTGTTCTGGGCCTGCTGAGGATGGCAGAGCTGGTGTCCATCCAGCACTGACCAGCCCTGATTCCCCGACCACCGCCCAGGGTGGAGAAGGAGGCCCTTGCTTGGCGTGGGGGATGGCTTAACTGTACCTGTTTGGATGCTTCTGAATAGAAATAAAGTGGGTTTTCCCTGGAGGT

esiRNA cDNA target sequence

GAAGGCTGCGGATCAACAATCAGGCGCCTCTGCTTCCAGGGCGCCGGGGGCCTGACTCGGTGGTGAGTGCGGCTGCCTTCGTCAGGACGGGCGAGCGTGGCTCTCGACGGCTGGGCGGGCTAGCTGACTCCTCCTTCGGCCCGGAAGGCAGTTCTCAGGGCCGCCCGACCCCCGCTCCCTGCCTAAGTCCTTGGGCTTGGACTTGTATAACAGTTTTGCTTTCTTTTCCTTTCGGTTTATTTTTTCAGTCAACCCAGGCTAGTCTCGAATTTGCGGCAATCCTCCTGCCTCCAATCGTTCTAGGTGCTGGGATTACTGGTGTGCAGCACCTCGGCTGTCTCTTCAGATTTTCTGCAGGTT

esiRNA cDNA target sequence

TGGGAGTGACAGATGATGGAGAAGGAAGTCATATTCTTCAATCTCCATCAGCCAATGTGCTTCCAACCCTTCCTTTCCACGTCCTTCGTAGCTTGTTTAGCACTACACCTTTGACAACTGATGATGGTGTACTTCTAAGGCGGATGGCATTGGAAATTGGAGCCTTACACCTCATTCTTGTCTGTCTCTCTGCTTTGAGCCACCATTCCCCACGAGTTCCAAACTCTAGCGTGAATCAAACTGAGCCACAGGTGTCAAGCTCTCATAACCCTACATCAACAGAAGAACAACAGTTATATTGGGCCAAAGGGACTGGCTTTGGAACAGGCTCTACAGCTTCTGGGTGGGATGTGGAACAAGCCTTAACTAAGCAAAGGCTGGAAGAGGAACATGTTACCTGCCTTCTGCAGGTT

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized, lyophilized powder

form

lyophilized, lyophilized powder

form

lyophilized powder

form

lyophilized powder

shipped in

ambient

shipped in

ambient

shipped in

ambient

shipped in

ambient

General description

Proteoprep 20 is an immunodepletion kit that removes 20 abundant interferring proteins from plasma or serum to allow analysis of less abundant proteins. Proteoprep 20 removes: albumin, IgG, transferrin, fibrinogen, IgA, α2- Marcroglobulin, IgM, α1- Antitrypsin, complement C3, haptoglobulin, apolipoprotein A1, A3 and B; α1- Acid Glycoprotein, ceruloplasmin, complement C4, C1q; IgD, prealbumin, and plasminogen.

Application

The ProteoPrep 20 Plasma Immunodepletion Kit specifically removes 20 of the most abundant proteins from human plasma or serum in preparation for further proteomics analysis. This depletion enables deeper penetration into the plasma proteome whether you use one- or two-dimensional electrophoresis, single or multidimensional chromatography or go straight to mass spectrometry. This is based on a unique conjugation process using small recombinant immunoaffinity ligands and conventional antibodies that permits high density conjugation on the support. The ligand selection ensures optimal specificity. Typical depletions remove 97-98% of the total protein mass in human plasma or serum.

Features and Benefits

• Increase your ability to visualize low abundance proteins and biomarkers – Removal of >99% of twenty of the most abundant proteins allows up to 50-fold increased protein loads, enhancing opportunities to visualize low abundance proteins

• Unique antibody affinity media – Novel high density antibody media displays higher specificity, reducing contamination and significantly improving depletion capacity compared to any currently available products

• Convenient spin-column format Fast depletion and recovery accelerates throughput and validation making this the preferred choice for all proteomics labs

Legal Information

ProteoPrep is a registered trademark of Merck KGaA, Darmstadt, Germany

Kit Components Also Available Separately

Product No.
Description
SDS

  • Luer lock syringe

  • Ultrafree-MC microcentrifuge filters, MWCO 5 kDa, PLCC cellulosic (regenerated cellulose) membrane

related product

Product No.
Description
Pricing

Pictograms

Exclamation mark

Signal Word

Warning

Hazard Statements

Hazard Classifications

Skin Sens. 1

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

  1. Can the Product PROT20, ProteoPrep Plasma Immunodepletion Kit, columns be re-used?

    With proper cleaning and storage, each column may be reused at least 100 times.

  2. The Product PROT20, ProteoPrep Plasma Immunodepletion Kit, bulletin indicates that 8 microliters of plasma are loaded on to the column. I have more than 8 microliters of plasma. Can I load greater than 8 microliters according to the procedure? 

    We optimized the protocol for dilution of about 8 microliters of plasma to 100 microliters with the 1× Equilibration Buffer. It is probably best to dilute 8 or so microliters at a time and load on the column for depletion. This process can be repeated for the full sample.

  3. Can I use Product PROT20, ProteoPrep Plasma Immunodepletion Kit, columns on plasma from other species, e.g. monkey?

    The antibodies on the PROT20 column are specific for depletion of human plasma proteins. We would not recommend this product for other species. The PROTBA is a more economical possibility to try, even though that depletes only two proteins from serum.

  4. Are the Product PROT20, ProteoPrep Plasma Immunodepletion Kit, columns available as stand-alone products?

    The columns are not available separately from the kit. The only kit components available separately are CLS8160 and M0286. We offer a smaller scale kit, PROT20S, which has one column instead of 3.

  5. Is there a point in the protocol for Product PROT20, ProteoPrep Plasma Immunodepletion Kit, where I can stop in the middle?

    In general, it is best to complete the depletion procedure once it is started. However, the customer can, if necessary, stop the procedure after the primary depletion and store the depleted samples frozen. The customer can then elute the bound proteins from the resin later and reuse it for re-depletion of the sample.

  6. Which document(s) contains shelf-life or expiration date information for a given product?

    If available for a given product, the recommended re-test date or the expiration date can be found on the Certificate of Analysis.

  7. How do I get lot-specific information or a Certificate of Analysis?

    The lot specific COA document can be found by entering the lot number above under the "Documents" section.

  8. How do I find price and availability?

    There are several ways to find pricing and availability for our products. Once you log onto our website, you will find the price and availability displayed on the product detail page. You can contact any of our Customer Sales and Service offices to receive a quote.  USA customers:  1-800-325-3010 or view local office numbers.

  9. What is the Department of Transportation shipping information for this product?

    Transportation information can be found in Section 14 of the product's (M)SDS.To access the shipping information for this material, use the link on the product detail page for the product. 

  10. My question is not addressed here, how can I contact Technical Service for assistance?

    Ask a Scientist here.

Tara K Sigdel et al.
Pediatric transplantation, 12(7), 737-747 (2008-09-04)
The desire for biomarkers for diagnosis and prognosis of diseases has never been greater. With the availability of genome data and an increased availability of proteome data, the discovery of biomarkers has become increasingly feasible. However, the task is daunting
Jon M Jacobs et al.
Journal of proteome research, 4(4), 1073-1085 (2005-08-09)
Candidate proteomic biomarker discovery from human plasma holds both incredible clinical potential as well as significant challenges. The dynamic range of proteins within plasma is known to exceed 10(10), and many potential biomarkers are likely present at lower protein abundances.
Tara K Sigdel et al.
Frontiers in medicine, 4, 80-80 (2017-07-04)
Identification and use of non-invasive biomarkers for kidney transplantation monitoring is an unmet need. A total of 121 biobanked sera collected from 111 unique kidney transplant (KT) patients (children and adolescent) and 10 age-matched healthy normal controls were used to
Removal of albumin from multiple human serum samples.
K Rengarajan et al.
BioTechniques, 20(1), 30-32 (1996-01-01)
Nitin Seam et al.
Clinical chemistry, 53(11), 1915-1920 (2007-09-25)
Prefractionation techniques such as serum albumin depletion are useful precursors to proteomic analysis, but they may introduce preanalytical bias if the depletion is not reproducible. We examined the reproducibility of albumin immunodepletion and describe a method of QC for this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service