HM0002
MISSION® miRNA, Negative Control 1
Synonym(s):
Mature Sequence: GGUUCGUACGUACACUGUUCA
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
UNSPSC Code:
12352200
Recommended Products
storage temp.
−20°C
General description
MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
replaced by
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service