HLTUD2167
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-6125
Synonym(s):
Tough Decoy, TuD
About This Item
product line
MISSION®
concentration
≥1x106 VP/ml (via p24 assay)
technique(s)
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
mature sequence
GCGGAAGGCGGAGCGGCGGA
Sanger mature/minor accession no.
Sanger microRNA accession no.
shipped in
dry ice
storage temp.
−70°C
General description
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other Notes
Legal Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service