Skip to Content
Merck
All Photos(1)

Key Documents

EMU076851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mfn2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$534.00
50 μG
$953.00

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$534.00
50 μG
$953.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAATACGCCAGTGAGAAGCTACAGCTCATCATCAGTTACACCGGCTCTAACTGCAGCCACCAAGTCCAGCAGGAATTGTCTGGGACATTTGCTCATCTGTGCCAGCAAGTTGACATCACCCGAGATAATCTGGAGCAGGAAATTGCTGCCATGAACAAGAAAGTCGAGGCTCTGGATTCACTTCAGAGCAGAGCCAAACTGCTCAGGAATAAAGCTGGCTGGTTGGACAGCGAACTCAACATGTTCACACACCAGTACCTGCAGCCCAGCAGATAGTGGGCAGCCAGGGCGGACCTGCACGAAGAAGAGGCAGGGCCGACCTCCCATCAGCTCTAGTCCTTGGCCGCTGCAGAGAGAAGGAAAGCACCCAGTCTTGTACCAGTTACTCCCTACCCCCTGCAGGAAGACCCCTGGCTCATACCCTAATGGAGACCAACAAGGACTGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S Givvimani et al.
International journal of cardiology, 187, 325-333 (2015-04-05)
Mitochondria constitute 30% of cell volume and are engaged in two dynamic processes called fission and fusion, regulated by Drp-1 (dynamin related protein) and mitofusin 2 (Mfn2). Previously, we showed that Drp-1 inhibition attenuates cardiovascular dysfunction following pressure overload in
Alejandro Martorell-Riera et al.
The EMBO journal, 33(20), 2388-2407 (2014-08-26)
Mitochondrial fusion and fission is a dynamic process critical for the maintenance of mitochondrial function and cell viability. During excitotoxicity neuronal mitochondria are fragmented, but the mechanism underlying this process is poorly understood. Here, we show that Mfn2 is the

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service