Skip to Content
Merck
All Photos(1)

Key Documents

EHU157941

Sigma-Aldrich

MISSION® esiRNA

targeting human HAND2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACTCAGAGCATCAACAGCGCCTTCGCCGAACTGCGCGAGTGCATCCCCAACGTACCCGCCGACACCAAACTCTCCAAAATCAAGACCCTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGACCTGCTGGCCAAGGACGACCAGAATGGCGAGGCGGAGGCCTTCAAGGCAGAGATCAAGAAGACCGACGTGAAAGAGGAGAAGAGGAAGAAGGAGCTGAACGAAATCTTGAAAAGCACAGTGAGCAGCAACGACAAGAAAACCAAAGGCCGGACGGGCTGGCCGCAGCACGTCTGGGCCCTGGAGCTCAAGCAGTGAGGAGGAGGAGAAGGAGGAGGAGGAGAGCGCGAGTGAGCAGGGGCCAAGGCGCCAGATGCAGACCCAGGACTCCGGAAAAGCCGTCCGCGCTCCGCTCTGAGGACTCCTTGCATTTGGAATCATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nao Kato et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(7), 979-987 (2018-10-03)
Several features exist that distinguish endometriotic cells from eutopic endometrial cells. Progesterone resistance is one of the main distinguishing features, although how progesterone resistance affects the phenotype of endometriotic cells is not fully elucidated. Heart and neural crest derivatives expressed
Mirna Marinić et al.
eLife, 10 (2021-02-02)
The developmental origins and evolutionary histories of cell types, tissues, and organs contribute to the ways in which their dysfunction produces disease. In mammals, the nature, development and evolution of maternal-fetal interactions likely influence diseases of pregnancy. Here we show

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service