Skip to Content
Merck
All Photos(1)

Key Documents

EHU130941

Sigma-Aldrich

MISSION® esiRNA

targeting human FGL2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$534.00
50 μG
$953.00

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$534.00
50 μG
$953.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCAAAGAGGAGATCAATGTACTTCATGGTCGCCTGGAGAAGCTGAATCTTGTAAATATGAACAACATAGAAAATTATGTTGACAGCAAAGTGGCAAATCTAACATTTGTTGTCAATAGTTTGGATGGCAAATGTTCAAAGTGTCCCAGCCAAGAACAAATACAGTCACGTCCAGTTCAACATCTAATATATAAAGATTGCTCTGACTACTACGCAATAGGCAAAAGAAGCAGTGAGACCTACAGAGTTACACCTGATCCCAAAAATAGTAGCTTTGAAGTTTACTGTGACATGGAGACCATGGGGGGAGGCTGGACAGTGCTGCAGGCACGTCTCGATGGGAGCACCAACTTCACCAGAACATGGCAAGACTACAAAGCAGGCTTTGGAAACCTCAGAAGGGAATTTTGGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Tang et al.
Scientific reports, 7(1), 12676-12676 (2017-10-06)
Fibrinogen-like protein 2 (FGL2) is highly expressed in various tumour tissues and plays a vital role in tumour initiation and progression. This study evaluated the clinical significance of FGL2 in patients with clear cell renal cell carcinoma (ccRCC). FGL2 expression
Yueying Wang et al.
Molecular reproduction and development, 86(4), 354-369 (2019-01-12)
Embryonic implantation involves a complex and well-coordinated interaction between the developing conceptus and maternal uterus, and the preimplantation period has a major impact on litter size in pigs. The present study aimed to investigate the vital messenger RNAs (mRNAs) and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service