Skip to Content
Merck
All Photos(1)

Documents

EHU127401

Sigma-Aldrich

MISSION® esiRNA

targeting human BRAF

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGA

Ensembl | human accession no.

ENSG00000157764

NCBI accession no.

NM_004333

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BRAF(673) , BRAF(673)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lin Feng et al.
Biochemical and biophysical research communications, 524(1), 28-35 (2020-01-26)
BRAFV600E mutation is frequently observed in melanoma, and contributes to tumor malignancy. Despite inhibition of BRAF causes a profound cell growth inhibition and a strong clinical benefit in BRAFV600E melanoma, acquired drug resistance is still the major hurdle. In this
Yujuan Zhang et al.
Nanomedicine : nanotechnology, biology, and medicine, 14(5), 1679-1693 (2018-04-24)
Melanoma is significantly associated with mutant BRAF gene, a suitable target for siRNA-based anti-melanoma therapy. However, a tumor-specific delivery system is a major hurdle for clinical applications. Here, we developed a novel nano-carrier, FA-GNR-siBRAF for safe topical application, which consists
Hitoshi Sase et al.
Molecular cancer therapeutics, 17(10), 2217-2225 (2018-07-27)
FGFR2 gene is frequently amplified in gastric cancer. Recently, targeting FGFR2 has drawn attention as a form of gastric cancer therapy, and FGFR-selective inhibitors have shown promising efficacy in clinical studies. Because overcoming acquired resistance is a common problem with
Xin Zhang et al.
The EMBO journal, 38(15), e100871-e100871 (2019-07-16)
Reactive oxygen species (ROS) are emerging as important regulators of cancer growth and metastatic spread. However, how cells integrate redox signals to affect cancer progression is not fully understood. Mitochondria are cellular redox hubs, which are highly regulated by interactions
Samantha K McCarty et al.
Endocrine-related cancer, 21(6), 865-877 (2014-09-18)
Increased p21-activated kinase (PAK) signaling and expression have been identified in the invasive fronts of aggressive papillary thyroid cancers (PTCs), including those with RET/PTC, BRAFV600E, and mutant RAS expression. Functionally, thyroid cancer cell motility in vitro is dependent on group
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service