Skip to Content
Merck
All Photos(1)

Key Documents

EHU126681

Sigma-Aldrich

MISSION® esiRNA

targeting human APRT

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$534.00
50 μG
$953.00

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$534.00
50 μG
$953.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCACCTGTACCCTTCTTCTCTCTCCTGCAGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTGGATCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACAGGGAACACATTCCTTTGCTGGGGTTCAGCGCCTCTCCTGGGGCTGGAAGTGCCAAAGCCTGGGGCAAAGCTGTGTTTCAGCCACACTGAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jon Pey et al.
Scientific reports, 7(1), 14358-14358 (2017-11-01)
Constraint-based modeling for genome-scale metabolic networks has emerged in the last years as a promising approach to elucidate drug targets in cancer. Beyond the canonical biosynthetic routes to produce biomass, it is of key importance to focus on metabolic routes
Yi-Fang Cheng et al.
PloS one, 10(11), e0142283-e0142283 (2015-11-07)
The AMP-activated protein kinase (AMPK) signaling system plays a key role in cellular stress by repressing the inflammatory responses induced by the nuclear factor-kappa B (NF-κB) system. Previous studies suggest that the anti-inflammatory role of AMPK involves activation by adenine

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service