Skip to Content
Merck
All Photos(1)

Key Documents

EHU096141

Sigma-Aldrich

MISSION® esiRNA

targeting human MAX

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$534.00
50 μG
$953.00

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$534.00
50 μG
$953.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGATTCGCAGCACAGAGTCGCTGGCATGTTTCACTCCTGCTTCTCTCAGCCAGCTGTTTAAGCCTGCGGCGCCAGCCTCACGGAGGGCCGTGTGACACTCTCGTGGTATGTATGGGAGATGGCAGCAGTGAAGCAGCAGCCACCAGGGAGTGGCCATTTGGGGTTGGGACAGGGAGGGTGTTTTGGGTGGCATAGAGGTTTTGTATTGAGGGCCAGTGATGATGTTTTGATATTTATTTCCTGCTACTTAAATTTGAATCTGAGTGAATTGTACCTATTTCTGATGATGTCGGTCTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tsz-Lun Yeung et al.
Oncotarget, 8(10), 16951-16963 (2017-02-16)
Transcription factors are master switches for various biochemical pathways. However, transcription factors involved in the pathogenesis of ovarian cancer have yet to be explored thoroughly. Therefore, in the present study, we assessed the prognostic value of the transcription factor E74-like
Olivier Godfroy et al.
The Plant cell, 29(12), 3102-3122 (2017-12-07)
Brown algae are one of the most developmentally complex groups within the eukaryotes. As in many land plants and animals, their main body axis is established early in development, when the initial cell gives rise to two daughter cells that
Mi-Ok Lee et al.
Biochemical and biophysical research communications, 520(2), 406-412 (2019-10-15)
Selenium (Se) plays a vital role in reactive oxygen species (ROS) homeostasis and redox regulation in intracellular signaling via selenocysteine (Sec), known as the 21st proteinogenic amino acid, but its specific biological functions in development and disease remain undiscovered. In
Farah Sharieh et al.
Alcoholism, clinical and experimental research, 44(6), 1204-1213 (2020-04-19)
During bone fracture repair, resident mesenchymal stem cells (MSCs) differentiate into chondrocytes, to form a cartilaginous fracture callus, and osteoblasts, to ossify the collagen matrix. Our laboratory previously reported that alcohol administration led to decreased cartilage formation within the fracture
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service