Skip to Content
Merck
All Photos(1)

Documents

EHU079681

Sigma-Aldrich

MISSION® esiRNA

targeting human S1PR1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCTCCTCAACGTTCTTTTACTTTATACTTTAACTACCTGAGAGTTATCAGAGCTGGGGTTGTGGAATGATCGATCATCTATAGCAAATAGGCTATGTTGAGTACGTAGGCTGTGGGAAGATGAAGATGGTTTGGAGGTGTAAAACAATGTCCTTCGCTGAGGCCAAAGTTTCCATGTAAGCGGGATCCGTTTTTTGGAATTTGGTTGAAGTCACTTTGATTTCTTTAAAAAACATCTTTTCAATGAAATGTGTTACCATTTCATATCCATTGAAGCCGAAATCTGCATAAGGAAGCCCACTTTATCTAAATGATATTAGCCAGGATCCTTGGTGTCCTAGGAGAAACAGACAAGCAAAACAAAGTGAAAACCGAATGGATTAACTTTTGCAAACCAAGGGA

Ensembl | human accession no.

ENSG00000170989

NCBI accession no.

NM_001400

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S1PR1(1901) , S1PR1(1901)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lan Xiao et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 33(6), 1090-1104 (2018-01-30)
Accumulating evidence indicates that the immune and skeletal systems interact with each other through various regulators during the osteoclastogenic process. Among these regulators, the bioactive lipid sphingosine-1-phosphate (S1P), which is synthesized by sphingosine kinase 1/2 (SPHK1/2), has recently been recognized
Akira Nomachi et al.
PloS one, 8(12), e82590-e82590 (2013-12-21)
The lipid mediator sphingosine 1-phosphate (S1P) regulates a wide range of cellular activities, including vascular maturation, angiogenesis, and immune-cell trafficking. Among the five known receptors for S1P (S1PR1-S1PR5), S1PR1 is a critical regulator of lymphocyte trafficking: its signaling is required
Shilun Zuo et al.
Molecular neurobiology, 54(2), 1213-1228 (2016-01-29)
Blood-brain barrier preservation plays an important role in attenuating vasogenic brain edema after subarachnoid hemorrhage (SAH). This study was designed to investigate the protective effect and mechanism of artesunate, a traditional anti-malaria drug, on blood-brain barrier after SAH. Three hundred
Veronica Lifshitz et al.
Molecular cancer therapeutics, 16(11), 2516-2527 (2017-07-19)
Drug resistance is a major barrier for the development of effective and durable cancer therapies. Overcoming this challenge requires further defining the cellular and molecular mechanisms underlying drug resistance, both acquired and environment-mediated drug resistance (EMDR). Here, using neuroblastoma (NB)
H-X Wu et al.
European review for medical and pharmacological sciences, 21(1), 108-114 (2017-01-26)
MicroRNAs (miRs) regulate the proliferation and metastasis of numerous cancer cell types. This study aimed to reveal the role of microRNA-542-3p (miR-542-3p) in breast cancer (BC) cell proliferation and its potential mechanisms. MiR-542-3p expression was detected by reverse transcription-polymerase chain
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service