Skip to Content
Merck
All Photos(1)

Key Documents

EHU063501

Sigma-Aldrich

MISSION® esiRNA

targeting human CAV3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$534.00
50 μG
$953.00

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$534.00
50 μG
$953.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCACACGGTGTAGGGAAGCCAGAAAGAAAAGACGGCCCAGCCACAGAAGCACAATGGCCCTTCGCTCTCCCCCAGCCCCACCATGATGCCCCCATGCCTGGGCGTGGGGGAAGATCATTTGCCAAGAGGCAGCTACTGCAAGTCTTTGCGTTCACTTGTACTGTAACAACATAAACCAGCACGCGGTTCCCACCCGGGGCCAACCTCTCCACGCGCACTCAGGAAAGTGACCAGTGACCACTGGCGTTAGGAAGGTGGCTCCAGTAAAGGGTTTTGGCTGCATTTGGGGAATGCTGCATTTTGTTCGTGCCTGTAAGATTGGTTTGTGTCCTGACCAGCTCCAAAAATATACTTCACTGCCCTGAAAAACAGACACAGGGAGAGTTGGTTGTCTCTTCACTTGGCCAAATGTAAGTGAAGAACAGAGTCTTTTTCTTCTTCGGATTCTATTGTTTGCTGGAACCGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Melissa Dewulf et al.
Nature communications, 10(1), 1974-1974 (2019-05-01)
Caveolin-3 is the major structural protein of caveolae in muscle. Mutations in the CAV3 gene cause different types of myopathies with altered membrane integrity and repair, expression of muscle proteins, and regulation of signaling pathways. We show here that myotubes
Shaoqing Lei et al.
Oxidative medicine and cellular longevity, 2019, 9836302-9836302 (2019-10-05)
Diabetic hearts are more vulnerable to ischemia/reperfusion (I/R) injury and less responsive to remifentanil preconditioning (RPC), but the underlying mechanisms are incompletely understood. Caveolin-3 (Cav-3), the dominant isoform of cardiomyocyte caveolae, is reduced in diabetic hearts in which oxidative stress

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service