Skip to Content
Merck
All Photos(1)

Key Documents

EHU024991

Sigma-Aldrich

MISSION® esiRNA

targeting human ADRM1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$534.00
50 μG
$953.00

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$534.00
50 μG
$953.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$534.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGAAAGATGTCCCTGAAGGGGACCACCGTGACTCCGGATAAGCGGAAAGGGCTGGTGTACATTCAGCAGACGGACGACTCGCTTATTCACTTCTGCTGGAAGGACAGGACGTCCGGGAACGTGGAAGACGACTTGATCATCTTCCCTGACGACTGTGAGTTCAAGCGGGTGCCGCAGTGCCCCAGCGGGAGGGTCTACGTGCTGAAGTTCAAGGCAGGGTCCAAGCGGCTTTTCTTCTGGATGCAGGAACCCAAGACAGACCAGGATGAGGAGCATTGCCGGAAAGTCAACGAGTATCTGAACAACCCCCCGATGCCTGGGGCGCTGGGGGCCAGCGGAAGCAGCGGCCACGAACTCTCTGCGCTAGGCGGTGAGGGTGGCCTGCAGAGCCTGCTGGGAAACATGAGCCACAGCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Marlena S Fejzo et al.
International journal of molecular sciences, 14(2), 3094-3109 (2013-02-05)
Approximately 25,000 ovarian cancers are diagnosed in the U.S. annually, and 75% are in the advanced stage and largely incurable. There is critical need for early detection tools and novel treatments. Proteasomal ubiquitin receptor ADRM1 is a protein that is
Yiping Huang et al.
Aging, 2(12), 959-968 (2010-12-31)
Oxidative stress was shown to promote the translocation of Ataxia-telangiectasia mutated (ATM) to cytoplasm and trigger the LKB1-AMPK-tuberin pathway leading to a down-regulation of mTOR and subsequently inducing the programmed cell death II (autophagy). Cisplatin was previously found to induce

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service