Skip to Content
Merck
All Photos(1)

Key Documents

EHU094381

Sigma-Aldrich

MISSION® esiRNA

targeting human SKP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shirly Lahav-Baratz et al.
Reproductive biomedicine online, 32(3), 308-315 (2016-01-23)
This preliminary study examined a possible effect of long duration repeated hormonal stimulation on the endometrium using a molecular tool. The expression of the hormone stimulated, cell cycle regulators, p27 and its ligase S-phase kinase-interacting protein2 (Skp2), were assessed in
Yingduan Cheng et al.
Oncotarget, 8(2), 1972-1982 (2016-12-29)
Recent findings on the existence of oncogenic fusion genes in a wide array of solid tumors, including head and neck squamous cell carcinoma (HNSCC), suggests that fusion genes have become attractive targets for cancer diagnosis and treatment. In this study
Wei Yan et al.
Cancer biotherapy & radiopharmaceuticals, 34(7), 451-458 (2019-04-27)
Background: Mantle cell lymphoma (MCL) is associated with poor patient prognosis mainly due to incomplete response to chemotherapy. S-phase
Gatha Thacker et al.
Life sciences, 257, 118041-118041 (2020-07-06)
Transcription factor CCAAT/Enhancer binding protein alpha (C/EBPα) is a key regulator of myeloid differentiation, granulopoiesis in particular. Although CEBPA mutations are found in more than 10% in AML, functional inhibition of C/EBPα protein is also widely observed in AML. Here
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service