Skip to Content
Merck
All Photos(1)

Key Documents

EHU076021

Sigma-Aldrich

MISSION® esiRNA

targeting human SPAG9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTTCTGTTGTTGGAGCAAGTGTATTTTACAAGGATGTTGCTGGTTTGGATACAGAAGGCAGTAAACAGCGAAGTGCCTCTCAGAGTAGTTTAGATAAGTTAGATCAGGAACTTAAGGAACAGCAGAAGGAGTTAAAAAATCAAGAAGAATTATCCAGTCTAGTTTGGATCTGTACCAGCACTCATTCGGCTACAAAAGTTCTTATTATTGATGCTGTTCAACCTGGCAACATCCTAGACAGTTTCACTGTTTGCAACTCTCATGTTCTGTGCATTGCAAGTGTGCCAGGTGCACGAGAAACAGACTACCCTGCAGGAGAAGATCTTTCAGAATCTGGTCAGGTAGACAAAGCATCTTTATGTGGAAGTATGACAAGCAACAGCTCAGCAGAGACAGACAGCCTG

Ensembl | human accession no.

ENSG00000008294

NCBI accession no.

NM_003971

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SPAG9(9043) , SPAG9(9043)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qin Hui Sun et al.
BMC cancer, 20(1), 522-522 (2020-06-07)
microRNAs (miRNAs) play essential roles in the development and progression of gastric cancer (GC). Although aberrant miR-874 expression has been reported in various human cancers, its role in GC remains obscure. miR-874 expression was assessed by real-time quantitative polymerase chain
Hui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(7), 6949-6954 (2014-04-18)
Sperm-associated antigen 9 (SPAG9) was recently reported to be overexpressed in several cancers and associated with the malignant behavior of cancer cells. However, the expression pattern of SPAG9 and its clinical significance in human prostate cancer have not been reported.
Feifei Chen et al.
Oncology reports, 32(6), 2533-2540 (2014-10-14)
Sperm-associated antigen 9 (SPAG9) is a recently characterized oncoprotein involved in the progression of several human malignancies. To elucidate the role of SPAG9 in the development of human prostate cancer (PCa), tissue microarray (TMA) and immunohistochemistry were used to detect
Zhi-Feng Miao et al.
Virchows Archiv : an international journal of pathology, 467(5), 525-533 (2015-08-22)
Sperm associated antigen 9 (SPAG9) protein has been found to play an important role in cancer progression but the involved mechanisms are still obscure. Its clinical significance in human gastric cancers remains unexplored. In the present study, SPAG9 expression was
Luis Bonet-Ponce et al.
Science advances, 6(46) (2020-11-13)
Genetic variation around the LRRK2 gene affects risk of both familial and sporadic Parkinson's disease (PD). However, the biological functions of LRRK2 remain incompletely understood. Here, we report that LRRK2 is recruited to lysosomes after exposure of cells to the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service