Skip to Content
Merck
All Photos(1)

Key Documents

EHU015291

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCATCTACCGAAGACACTCATGAAGTAGATTCCAAAGCAGCTTTAATACCGGATTGGTTACAAGATAGACCATCAAACAGAGAAATGCCATCTGAAGAAGGAACATTAAATGGTCTCACTTCTCCATTTAAGCCAGCTATGGATACAAATTACTATTATTCAGCTGTGGAAAGAAATAACTTGATGAGGTTATCACAGAGCATTCCATTTACACCTGTGCCTCCAAGAGGGGAGCCTGTCACAGTGTATCGTTTGGAAGAGAGTTCACCCAACATACTAAATAACAGCATGTCTTCTTGGTCACAACTAGGCCTCTGTGCCAAAATAGAGTTTTTAAGCAAAGAGGAGATGGGAGGAGGTTTACGAAGAGCTGTCAAAGTACAGTGTACCTGGTCAGAACATGATATCCTCAAATCAGGGCATCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Constantin Römmelt et al.
Journal of biomedical materials research. Part B, Applied biomaterials, 107(6), 1806-1813 (2018-12-07)
The reasons for the high number of loosened metal-on-metal (MoM) hip implants are still not fully understood. Hypoxia-inducible factor 1 (HIF-1) mediated signaling pathways, which normally modulate tissue metabolism under hypoxic circumstances, could be triggered by metallic wear debris and
Heyu Zhang et al.
Frontiers in neurology, 9, 931-931 (2018-11-22)
Intracerebral hemorrhage (ICH) has high morbidity and mortality, with no effective treatment at present. One possible therapeutic strategy involves the use of mesenchymal stem cells (MSCs), which have shown promise in experimental models and have great potential for treating nervous
Mingyang Yu et al.
Molecular medicine reports, 22(4), 2741-2752 (2020-09-19)
Gallium (Ga) ions have been widely utilized for biomedical applications; however, their role in osteoblast regulation is not completely understood. The aim of the present study was to investigate the potential effect of Ga ions on osteoinduction in two osteoblast cell
Yuqiang Liu et al.
Cell reports, 23(12), 3480-3491 (2018-06-21)
The TRPM7 chanzyme contributes to several biological and pathological processes in different tissues. However, its role in the CNS under physiological conditions remains unclear. Here, we show that TRPM7 knockdown in hippocampal neurons reduces structural synapse density. The synapse density
Xiuzhi Zhang et al.
Acta biomaterialia, 63, 369-382 (2017-09-09)
Mg-based alloys, as the potential orthopaedic implant, can self-degrade to avoid second operation for its remove, and enable to promote bone repair; however, the underlying molecular mechanisms remain unclear. In the present study, we examined the effect of Mg ions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service