Skip to Content
Merck
All Photos(1)

Key Documents

EHU016741

Sigma-Aldrich

MISSION® esiRNA

targeting human APEX2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGAAACCAAAGTGACCAGGGATGCACTGACAGAGCCCCTGGCTATCGTTGAGGGTTATAACTCCTATTTCAGCTTCAGCCGCAACCGTAGCGGCTATTCTGGTGTAGCCACCTTCTGTAAGGACAATGCTACCCCAGTGGCTGCTGAAGAAGGCCTGAGTGGCCTGTTTGCCACCCAGAATGGGGATGTTGGTTGCTATGGAAACATGGATGAGTTTACCCAAGAGGAACTCCGGGCTCTGGATAGTGAGGGCAGGGCCCTCCTCACACAGCATAAGATCCGCACATGGGAAGGTAAGGAGAAGACCTTGACCCTAATCAACGTGTACTGCCCCCATGCGGACCCTGGGAGGCCTGAGCGGCTAGTCTTTAAGATGCGCTTCTATCGTTTGCTGCAAATCCGAGCAGAAGCCCTCCTGGCGGCAGGCAGCCATGTGATCATTCTGGGTGACCTGAATACAGCCCACCGCCCCATTGACCACTGGGATGCAGTCAACCTGGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kavi P M Mehta et al.
Cell reports, 31(9), 107705-107705 (2020-06-04)
5-Hydroxymethylcytosine (5hmC) binding, ES-cell-specific (HMCES) crosslinks to apurinic or apyrimidinic (AP, abasic) sites in single-strand DNA (ssDNA). To determine whether HMCES responds to the ssDNA abasic site in cells, we exploited the activity of apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like
Kristen E Mengwasser et al.
Molecular cell, 73(5), 885-899 (2019-01-29)
BRCA1 or BRCA2 inactivation drives breast and ovarian cancer but also creates vulnerability to poly(ADP-ribose) polymerase (PARP) inhibitors. To search for additional targets whose inhibition is synthetically lethal in BRCA2-deficient backgrounds, we screened two pairs of BRCA2 isogenic cell lines

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service