Skip to Content
Merck
All Photos(1)

Key Documents

EHU046811

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A10

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAATTCGCTGGGGATAAAGGCTACTTAACAAAGGAGGACCTGAGAGTACTCATGGAAAAGGAGTTCCCTGGATTTTTGGAAAATCAAAAAGACCCTCTGGCTGTGGACAAAATAATGAAGGACCTGGACCAGTGTAGAGATGGCAAAGTGGGCTTCCAGAGCTTCTTTTCCCTAATTGCGGGCCTCACCATTGCATGCAATGACTATTTTGTAGTACACATGAAGCAGAAGGGAAAGAAGTAGGCAGAAATGAGCAGTTCGCTCCTCCCTGATAAGAGTTGTCCCAAAGGGTCGCTTAAGGAATCTGCCCCACAGCTTCCCCCATAGAAGGATTTCATGAGCAGATCAGGACACTTAGCAAATGTAAAAATAAAATCTAACTCTCATTTGACAAGCAGAGAAAGAAAAGTTAAATACCAGATAAGCTTTTGATTTTTGTATTGTTTGCATCCCCTTGC

Ensembl | human accession no.

ENSG00000197747

NCBI accession no.

NM_002966

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S100A10(6281) , S100A10(6281)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Li et al.
Frontiers in cell and developmental biology, 8, 559486-559486 (2020-12-17)
S100 calcium-binding protein A10 (S100A10) is crucially involved in the tumorigenesis of multiple malignant tumors. Reprogrammed glucose metabolism is emerging as a hallmark of various human cancers. However, the function of S100A10 in aerobic glycolysis is unclear. The expression of
Moamen Bydoun et al.
Scientific reports, 8(1), 14091-14091 (2018-09-22)
Cancer dissemination is initiated by the movement of cells into the vasculature which has been reported to be triggered by EMT (epithelial to mesenchymal transition). Cellular dissemination also requires proteases that remodel the extracellular matrix. The protease, plasmin is a
K-W Lee et al.
Molecular psychiatry, 20(12), 1546-1556 (2015-09-16)
Mood disorders and antidepressant therapy involve alterations of monoaminergic and glutamatergic transmission. The protein S100A10 (p11) was identified as a regulator of serotonin receptors, and it has been implicated in the etiology of depression and in mediating the antidepressant actions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service