Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU075291

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS35

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGAAGATGGACCTGGAATCCCAGCGGATATTAAACTTTTTGATATATTTTCACAGCAGGTGGCTACAGTGATACAGTCTAGACAAGACATGCCTTCAGAGGATGTTGTATCTTTACAAGTCTCTCTGATTAATCTTGCCATGAAATGTTACCCTGATCGTGTGGACTATGTTGATAAAGTTCTAGAAACAACAGTGGAGATATTCAATAAGCTCAACCTTGAACATATTGCTACCAGTAGTGCAGTTTCAAAGGAACTCACCAGACTTTTGAAAATACCAGTTGACACTTACAACAATATTTTAACAGTCTTGAAATTAAAACATTTTCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTGCTTAGTAATGTTCTGGATTATAACACAGAAATTGTCTCTCAAGACCAGGTGGATTCCAT

Numéro d'accès Ensembl | humain

ENSG00000069329

Numéro d'accès NCBI

NM_018206

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VPS35(55737) , VPS35(55737)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Peiqi Yin et al.
Cellular and molecular life sciences : CMLS, 73(4), 869-881 (2015-08-25)
Hepatitis C virus (HCV) has infected over 170 million people worldwide. Phosphatidylinositol 4-phosphate (PI4P) is the organelle-specific phosphoinositide enriched at sites of HCV replication. Whether retromer, a PI4P-related host transport machinery, unloads its cargo at HCV replication sites remains inconclusive.
Amod Godbole et al.
Nature communications, 8(1), 443-443 (2017-09-07)
A new paradigm of G-protein-coupled receptor (GPCR) signaling at intracellular sites has recently emerged, but the underlying mechanisms and functional consequences are insufficiently understood. Here, we show that upon internalization in thyroid cells, endogenous TSH receptors traffic retrogradely to the
Anna Ansell-Schultz et al.
Molecular and cellular neurosciences, 93, 18-26 (2018-09-27)
Alzheimer's disease (AD) is a neurodegenerative disorder characterized by a progressive loss of multiple cognitive functions. Accumulation of amyloid beta oligomers (oAβ) play a major role in the neurotoxicity associated with the disease process. One of the early affected brain
Prasad Tammineni et al.
Human molecular genetics, 26(22), 4352-4366 (2017-10-04)
Lysosomal proteolysis is essential for the quality control of intracellular components and the maintenance of cellular homeostasis. Lysosomal alterations have been implicated as one of the main cellular defects contributing to the onset and progression of Alzheimer's disease (AD). However
Santanu Das et al.
Journal of cell science, 133(24) (2020-12-04)
The Wilson disease protein, ATP7B maintains copper (herein referring to the Cu+ ion) homeostasis in the liver. ATP7B traffics from trans-Golgi network to endolysosomes to export excess copper. Regulation of ATP7B trafficking to and from endolysosomes is not well understood.
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique