Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EMU039131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plk1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTACAGCAGCTGACCAGTGTCAACGCCTCCAAGCCCTCGGAGCGCGGGCTGGTGCGGCAAGAGGAGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTATGGCCTTGGGTATCAGCTGTGTGACAACAGTGTGGGGGTGCTTTTTAATGACTCAACACGCCTGATTCTCTACAATGACGGGGACAGCCTGCAGTACATAGAGCGTGATGGCACGGAGTCCTATCTCACTGTGAGCTCCCATCCCAATTCCTTGATGAAGAAGATCACTCTCCTCAACTATTTCCGCAATTACATGAGTGAGCACCTGCTGAAGGCAGGACGCAACATCACACCCCGGGAAGGCGACGAGCTGGCCCGGCTGCCCTACCTACGAACGTGGTTCCGCACACGCAGCGCCATCATCCTGCACCTCAGCAACGGCACCGTGCAGATTAACTTCTTCCAGGACCACACCAAACTTATCCTGTGCCCCCT

Ensembl | mouse accession no.

ENSMUSG00000030867

NCBI accession no.

NM_011121

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... PLK1(18817) , Plk1(18817)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Riet van der Meer et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3211-3221 (2014-04-29)
To identify genes whose depletion is detrimental to Pim1-overexpressing prostate cancer cells and to validate this finding in vitro and in vivo. RNAi screening was used to identify genes whose depletion is detrimental to Pim1-overexpressing cells. Our finding was validated
Valentina Zuco et al.
Oncotarget, 6(11), 8736-8749 (2015-04-01)
Intrinsic and acquired tumor drug resistance limits the therapeutic efficacy of camptothecins (CPTs). Downregulation of the mitotic kinase PLK1 was found associated with apoptosis induced by SN38 (CPT11 active metabolite). We investigated the role of PLK1 in the cell response
Hui Tian et al.
Molecular cancer research : MCR, 13(4), 784-794 (2015-01-13)
Protein S-palmitoylation is a widespread and dynamic posttranslational modification that regulates protein-membrane interactions, protein-protein interactions, and protein stability. A large family of palmitoyl acyl transferases, termed the DHHC family due to the presence of a common catalytic motif, catalyzes S-palmitoylation;
Sixin Jiang et al.
Respiratory research, 16, 93-93 (2015-08-06)
Polo-like kinase 1 (Plk1) is a serine/threonine protein kinase that has been implicated in the regulation of mitosis. In addition, the activation of mitogen-activated protein kinase (MAPK) is a key event in the early stage of the growth factor response.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico