Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU138421

Sigma-Aldrich

MISSION® esiRNA

targeting human DHODH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGAAAGAGCAGGGCTTTGGCGGAGTCACAGATGCCATTGGAGCAGATCATCGGAGGTGAGGACAGCGTCTGACGGGAAGCCTGATCTGGAACCTTCCCAAGGACTCAGGCAAGCCTTTGTGGCTGGATCATGAGAGGAGGGACTCCATCTTGAGCCATGTCCCCCAGCCATGGCATGGCTGCACTGTAAACGCCAATCGGGGGGTCACCAGGATCAACCGCAGGCTTTCTTCAGTCCCTTGGTCAGACCATAAACTGCATTTTTGATTCTTTGTGGATTCAAACCCTAGGATCCATCAGTCTTGCAAGGACATTGAATATTAGGAGGAAAAAGTCATGGAAAAAATAAAGCCATTTAGAACCTGGGTTTCAACGCTAGCCCTTTCTGGTTTGCCATAGGCCCTGCCAAGATACTGCAGGTCCATCCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xuemei Qiu et al.
International journal of oral science, 13(1), 3-3 (2021-01-30)
Oral squamous cell carcinoma (OSCC) become a heavy burden of public health, with approximately 300 000 newly diagnosed cases and 145 000 deaths worldwide per year. Nucleotide metabolism fuel DNA replication and RNA synthesis, which is indispensable for cell proliferation.
Deepti Mathur et al.
Cancer discovery, 7(4), 380-390 (2017-03-04)
Metabolic changes induced by oncogenic drivers of cancer contribute to tumor growth and are attractive targets for cancer treatment. Here, we found that increased growth of PTEN-mutant cells was dependent on glutamine flux through the de novo pyrimidine synthesis pathway
Mathura Subangari Dorasamy et al.
Journal of Cancer, 8(15), 3086-3098 (2017-09-21)
Dihydroorotate dehydrogenase (DHODH) is a rate-limiting enzyme in the
T He et al.
Oncogene, 33(27), 3538-3549 (2013-09-10)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising agent in selectively killing tumor cells. However, TRAIL monotherapy has not been successful as many cancer cells are resistant to TRAIL. Chemotherapeutic agents, such as doxorubicin have been shown to act

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico