Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU124311

Sigma-Aldrich

MISSION® esiRNA

targeting human EGR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACTGATTTGGGGGACATTGTACAGTGAGTGAAGTATAGCCTTTATGCCACACTCTGTGGCCCTAAAATGGTGAATCAGAGCATATCTAGTTGTCTCAACCCTTGAAGCAATATGTATTATAAACTCAGAGAACAGAAGTGCAATGTGATGGGAGGAACATAGCAATATCTGCTCCTTTTCGAGTTGTTTGAGAAATGTAGGCTATTTTTTCAGTGTATATCCACTCAGATTTTGTGTATTTTTGATGTACACTGTTCTCTAAATTCTGAATCTTTGGGAAAAAATGTAAAGCATTTATGATCTCAGAGGTTAACTTATTTAAGGGGGATGTACATATATTCTCTGAAACTAGGATGCATGCAATTGTGTTGGAAGTGTCCTTGGTGCCTTGTGTGATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

C-S Zang et al.
European review for medical and pharmacological sciences, 24(9), 4890-4900 (2020-05-21)
Various microRNAs (miRNAs) have been reported to be involved in the pathogenesis and development of human cancers, including papillary thyroid carcinoma (PTC). However, the role of miR-224-5p in PTC progression remains unclear. Therefore, the purpose of this study is to
Qingtao Meng et al.
Oncotarget, 8(49), 86217-86226 (2017-11-22)
Cervical cancer is the second leading cause of mortality among women. Impairment of the base excision repair (BER) pathway is one of the major causes of the initiation and progression of cervical cancer. However, whether the polymorphisms of the BER
Xuzhi Liu et al.
Acta biochimica et biophysica Sinica, 47(6), 431-440 (2015-05-04)
Non-small-cell lung cancer (NSCLC) is one of the most common lung cancers, and microRNAs (miRNAs) have been reported to play essential roles in NSCLC. Recent studies have indicated that miR-330-3p expression is up-regulated in NSCLC samples and in tissues of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico