Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU108101

Sigma-Aldrich

MISSION® esiRNA

targeting human CKS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCGCTCTCGTTTCATTTTCTGCAGCGCGCCAGCAGGATGGCCCACAAGCAGATCTACTACTCGGACAAGTACTTCGACGAACACTACGAGTACCGGCATGTTATGTTACCCAGAGAACTTTCCAAACAAGTACCTAAAACTCATCTGATGTCTGAAGAGGAGTGGAGGAGACTTGGTGTCCAACAGAGTCTAGGCTGGGTTCATTACATGATTCATGAGCCAGAACCACATATTCTTCTCTTTAGACGACCTCTTCCAAAAGATCAACAAAAATGAAGTTTATCTGGGGATCGTCAAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTGAGAAATGTACAAATCTTTCATCCATACCTGTGCATGAGCTGTATTCTTCACAGCAACAGAGCTCA

Ensembl | nº de acceso humano

ENSG00000123975

Nº de acceso NCBI

NM_001827

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CKS2(1164) , CKS2(1164)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
NRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jun Li et al.
Cancer communications (London, England), 38(1), 13-13 (2018-05-17)
Pancreatic duct adenocarcinoma (PDAC) remains a major health problem because conventional cancer treatments are relatively ineffective against it. Microarray studies have linked many genes to pancreatic cancer, but the available data have not been extensively mined for potential insights into
Min-Hao Yu et al.
American journal of cancer research, 5(9), 2708-2718 (2015-11-27)
Cyclin-dependent kinases regulatory subunit 2 (CKS2) is a cyclin-dependent kinase-interacting protein, which is essential for cell cycle regulation. Elevated expression of CKS2 has been demonstrated in multiple types of human malignancies. However, the clinical significance, oncogenic functions and related mechanisms
Yupeng Deng et al.
Oncology letters, 18(3), 2845-2852 (2019-08-28)
Cyclin-dependent kinase subunit (CKS) 2 is a member of the CKS family, which plays an important role in the regulation of meiosis and mitosis. Overexpression of CKS2 has been reported in several types of tumors. However, few studies have investigated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico