Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU072201

Sigma-Aldrich

MISSION® esiRNA

targeting human LONP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAGCAATGAGTCGGATGTGGTCGAGAGCCTGGATGAAATCTACCACACGGGGACGTTTGCCCAGATCCATGAGATGCAGGACCTTGGGGACAAGCTGCGCATGATCGTCATGGGACACAGAAGAGTCCATATCAGCAGACAGCTGGAGGTGGAGCCCGAGGAGCCGGAGGCGGAGAACAAGCACAAGCCCCGCAGGAAGTCAAAGCGGGGCAAGAAGGAGGCGGAGGACGAGCTGAGCGCCAGGCACCCGGCGGAGCTGGCGATGGAGCCCACCCCTGAGCTCCCGGCTGAGGTGCTCATGGTGGAGGTAGAGAACGTTGTCCACGAGGACTTCCAGGTCACGGAGGAGGTGAAAGCCCTGACTGCAGAGATCGTGAAGACCATCCGGGACATCATTGCCTTGAACCC

Ensembl | nº de acceso humano

ENSG00000196365

Nº de acceso NCBI

NM_004793

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LONP1(9361) , LONP1(9361)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ADV
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Meng Zhao et al.
Theranostics, 11(4), 1845-1863 (2021-01-08)
Aims: Ischemia-reperfusion injury (IRI)-induced acute kidney injury (IRI-AKI) is characterized by elevated levels of reactive oxygen species (ROS), mitochondrial dysfunction, and inflammation, but the potential link among these features remains unclear. In this study, we aimed to investigate the specific
Olga Zurita Rendón et al.
Molecular and cellular biology, 38(20) (2018-08-01)
LONP1, an AAA+ mitochondrial protease, is implicated in protein quality control, but its precise role in this process remains poorly understood. In this study, we have investigated the role of human LONP1 in mitochondrial proteostasis and gene expression. Depletion of
Shiyuan Huang et al.
American journal of physiology. Cell physiology, 319(6), C1020-C1028 (2020-09-17)
Myoblast differentiation is a crucial process for myogenesis. Mitochondria function as an energy-providing machine that is critical to this process, and mitochondrial dysfunction can prevent myoblasts from fusing into myotubes. However, the molecular mechanisms underlying the dynamic regulation of mitochondrial
Marie Lagouge et al.
PLoS genetics, 11(8), e1005423-e1005423 (2015-08-08)
We have studied the in vivo role of SLIRP in regulation of mitochondrial DNA (mtDNA) gene expression and show here that it stabilizes its interacting partner protein LRPPRC by protecting it from degradation. Although SLIRP is completely dependent on LRPPRC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico