Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU044501

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53INP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCCAACTAAAGACAAGGTTTTGAAATCTCAGCTATAAAAGACATCCAGCCAAACTCTCAGTCTTGCCTTAACAATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTCAATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAAGAAGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTACCGGCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATGGAGGAGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAAACAAGTCCTATGGAAAACCTTCTCATTGAACATCCCAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mingming Zhu et al.
Cancer medicine, 9(22), 8639-8649 (2020-09-29)
Recently, long noncoding RNAs (lncRNAs) were recognized as significant therapeutic targets in tumors. Our previous microarray analysis showed that lncRNA TCONS_000026334 expression was reduced in metastatic colorectal cancer (CRC) tissues. The objective of this study was to research the biological
Yonggang Huang et al.
Journal of Cancer, 11(22), 6545-6555 (2020-10-14)
Liver tumor-initiating cells (T-ICs) contribute to tumorigenesis, progression, recurrence and drug resistance of hepatocellular carcinoma (HCC). However, the underlying mechanism for the propagation of liver T-ICs remains unclear. In the present study, our finding shows that miR-96 is upregulated in
Xiaohuan Xia et al.
Stem cell research & therapy, 10(1), 282-282 (2019-09-25)
Recent studies suggested that miR-17~106 family was involved in the regulation of neural stem/progenitor cells (NPCs). However, distinct function of each family member was reported in regulating stem cells within and without the brain. Hence, to investigate the roles of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico