Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU022821

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTC

Ensembl | human accession no.

ENSG00000121966

NCBI accession no.

NM_001008540

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CXCR4(7852) , CXCR4(7852)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lei Li et al.
Biochimica et biophysica acta. General subjects, 1862(8), 1790-1800 (2018-05-08)
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for
Markus Eberl et al.
EMBO molecular medicine, 4(3), 218-233 (2012-02-02)
Inhibition of Hedgehog (HH)/GLI signalling in cancer is a promising therapeutic approach. Interactions between HH/GLI and other oncogenic pathways affect the strength and tumourigenicity of HH/GLI. Cooperation of HH/GLI with epidermal growth factor receptor (EGFR) signalling promotes transformation and cancer
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Ying Wang et al.
Frontiers in oncology, 9, 1487-1487 (2020-02-13)
Purpose: Due to a lack of recognized molecular targets for therapy, patients with triple-negative breast cancer (TNBC), unlike other subtypes of breast cancers, generally have not benefited from the advances made with targeted agents. The CXCR4/SDF-1 axis is involved in
Nahyeon Kang et al.
BMC cancer, 19(1), 148-148 (2019-02-15)
A hypoxic microenvironment leads to an increase in the invasiveness and the metastatic potential of cancer cells within tumors via the epithelial-mesenchymal transition (EMT) and cancer stemness acquisition. However, hypoxia-induced changes in the expression and function of candidate stem cell
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico