Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU009041

Sigma-Aldrich

MISSION® esiRNA

targeting human FIGN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGCTCTGACAAACAGTTCAGCAAGTTCTCTCAAAAGGAAAGCTTTCTACATGGCAGGGCAAGGAGATATGGACTCCAGTTATGGAAATTACAGCTATGGCCAACAGAGATCTACACAGAGTCCTATGTACAGAATGCCCGACAACAGCATTTCAAACACAAATCGGGGGAATGGCTTTGACAGAAGTGCTGAAACATCATCCTTAGCATTTAAGCCAACGAAGCAGCTAATGTCCTCTGAACAGCAAAGGAAATTCAGCAGCCAGTCCAGTAGGGCTCTGACCCCTCCTTCCTACAGTACTGCTAAAAATTCATTGGGATCAAGATCCAGTGAATCCTTTGGGAAGTACACATCGCCAGTAATGAGTGAGCATGGGGACGAGCACAGGCAGCTCCTCTCTCACCCAATGCAAGGCCCTGGACTCCGTGCAGCTACCTCATCCAACCACTCTGTGGACGAGCAACTGAAGAATACTGACACGCACCTCATCGACCTGGTAACCAATGAGATTATCACCCAAGGACCTCCAG

Ensembl | nº de acceso humano

ENSG00000182263

Nº de acceso NCBI

NM_018086

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FIGN(55137) , FIGN(55137)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jian-Ming Lü et al.
International journal of molecular sciences, 20(2) (2019-01-16)
We have previously shown that ritonavir (RTV), a highly active anti-retroviral therapy (HAART) drug, can cause endothelial dysfunction through oxidative stress. Several antioxidants including ginsenoside Rb1, a compound with antioxidant effect, can effectively block this side effect of RTV in
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Xiaolong Yuan et al.
Genes, 9(6) (2018-06-15)
Previous studies suggest that signal transducer and activator of transcription 3 (STAT3) and CCAAT/enhancer binding protein beta (C/EBPβ) play an essential role in ovarian granulosa cells (GCs) for mammalian follicular development. Several C/EBPβ putative binding sites were previously predicted on
Xi-Feng Jin et al.
Cancers, 12(2) (2020-02-09)
Inhibition of Wnt/β-catenin signaling by specific inhibitors is currently being investigated as an antitumoral strategy for various cancers. The role of Wnt/β-catenin signaling in neuroendocrine tumors still needs to be further investigated. This study investigated the antitumor activity of the
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico