Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU063881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pecam1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGGAGTCCTTCTCCACTCCCAAGTTTGAAATCAAGCCCCCTGGGATGATCATAGAAGGGGACCAGCTGCACATTAGGTGCATAGTTCAAGTGACACACTTGGTCCAGGAGTTTACAGAAATTATCATCCAAAAAGACAAGGCGATTGTAGCCACCTCCAAGCAAAGCAGTGAAGCTGTCTACTCAGTCATGGCCATGGTCGAGTACAGTGGACACTACACCTGCAAAGTGGAATCAAACCGTATCTCCAAAGCCAGTAGCATCATGGTCAACATAACAGAGCTGTTTCCCAAGCCGAAGTTAGAGTTCTCCTCCAGTCGTCTGGACCAAGGGGAGTTGTTGGACCTGTCCTGCTCCGTCTCGGGCACACCTGTAGCCAACTTCACCATCCAGAAGGAAGAGACGG

Ensembl | mouse accession no.

ENSMUSG00000020717

NCBI accession no.

NM_008816

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... PECAM1(18613) , Pecam1(18613)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Masayasu Hara et al.
Anticancer research, 36(1), 169-177 (2016-01-02)
We evaluated the ability of itraconazole to enhance the effects of bevacizumab in bevacizumab-resistant cancer cells, endothelial cells, and cancer-associated fibroblasts (CAFs). Human gastrointestinal cancer cell lines (HT-29, MKN-28 and MKN-45), human umbilical vein endothelial cells (HUVECs), and CAFs established
Larissa Pfisterer et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(8), 3518-3527 (2014-04-29)
Despite the high prevalence of venous diseases that are associated with and based on the structural reorganization of the venous vessel wall, not much is known about their mechanistic causes. In this context, we demonstrated that the quantity of myocardin
Caroline Arnold et al.
EMBO molecular medicine, 6(8), 1075-1089 (2014-06-29)
Arteriogenesis-the growth of collateral arterioles-partially compensates for the progressive occlusion of large conductance arteries as it may occur as a consequence of coronary, cerebral or peripheral artery disease. Despite being clinically highly relevant, mechanisms driving this process remain elusive. In
James Shue-Min Yeh et al.
PloS one, 10(7), e0129681-e0129681 (2015-07-15)
Microbubbles conjugated with targeting ligands are used as contrast agents for ultrasound molecular imaging. However, they often contain immunogenic (strept)avidin, which impedes application in humans. Although targeting bubbles not employing the biotin-(strept)avidin conjugation chemistry have been explored, only a few
Yang Kyung Cho et al.
Cornea, 33(6), 621-627 (2014-04-15)
Dry eye disease is becoming recognized as an immune-inflammation mediated disorder. Surgical insults such as corneal incision or suture can aggravate dry eye. We sought to determine whether underlying dry eye aggravates corneal inflammatory infiltration, hemangiogenesis, and lymphangiogenesis (LY) induced
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service