Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU052231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Park7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCAGTGTAGCCGTGATGTAATGATTTGTCCAGATACCAGTCTGGAAGATGCAAAAACGCAGGGACCATACGATGTGGTGGTTCTTCCAGGAGGAAATCTGGGTGCACAGAATTTATCTGAGTCGCCTATGGTGAAGGAGATCCTCAAGGAGCAGGAGAGCAGGAAGGGCCTCATAGCTGCCATCTGTGCAGGTCCTACGGCTCTGTTGGCTCACGAAGTAGGTTTTGGATGCAAGGTCACAACACACCCACTGGCTAAGGACAAAATGATGAATGGCAGTCACTACAGCTACTCAGAGAGCCGCGTGGAGAAGGACGGCCTGATCCTCACCAGCCGCGGGCCGGGGACCAGCTTTGAGTTTGCACTAGCCATTGTGGAGGCACTCGTGGGGAAAGACATGGCCAACCAAGTGAAGGCACCGCTTGTTCTCAAAGACTAGAGCCCAAGCCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jung-Min Kim et al.
Scientific reports, 4, 4805-4805 (2014-06-14)
Adipose tissue functions as an endocrine organ, and the development of systemic inflammation in adipose tissue is closely associated with metabolic diseases, such as obesity and insulin resistance. Accordingly, the fine regulation of the inflammatory response caused by obesity has
Ismail Ahmed Ismail et al.
Journal of cellular physiology, 230(9), 2262-2269 (2015-02-14)
2'-Benzoyloxycinnamaldehyde (BCA) is a promising antitumor agent. BCA effectively inhibited proliferation of MDA-MB-435 more than in MCF-7 breast cancer cells. Our recent findings showed that DJ-1 protects MCF7 cells from BCA-induced oxidative stress via its mitochondrial translocation and inhibition of
Min Sik Choi et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(45), 15123-15131 (2014-11-08)
Emerging evidence suggests that oxidative/nitrosative stress, as occurs during aging, contributes to the pathogenesis of Parkinson's disease (PD). In contrast, detoxification of reactive oxygen species and reactive nitrogen species can protect neurons. DJ-1 has been identified as one of several
Hong Zhu et al.
Free radical biology & medicine, 71, 121-132 (2014-04-01)
Dihydroartemisinin (DHA), one of the main metabolites of artemisinin and its derivatives, presents anti-cancer potential in vitro and in vivo. To explore the mechanisms of resistance toward DHA, a DHA-resistant cell line, HeLa/DHA, was established with a resistance factor of
Cailing Liu et al.
Investigative ophthalmology & visual science, 55(9), 5551-5560 (2014-08-02)
To investigate the role of DJ-1 in Nrf2-regulated antioxidant defense in corneal endothelial cells (CECs) at baseline and in response to ultraviolet A (UV-A)-induced oxidative stress. DJ-1-deficient CECs were obtained by transfection of an immortalized normal human corneal endothelial cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service