Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU146141

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF8

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACTTTGTCCTTTGTGGATTGCATAGCTGGATACCCATCATCTGTTTCTCTGATTGGAAGCTGCTGTTGTACAGAAAGACCTGCATTTCCCCCTTGTCTCCAGTTCTCTCACTACTTTTTCCTCCTCTGTGAGTGACCATCCAGGCAGTCACCATAACTGCTGGAGTGTCTGGGATTGGTAGCTCTCTCCAACTGCCTGCTTGCTCTTTACAGCCTCTCTCTGTGACTGGAATCTCTCCACCTCATCGTATCTAAGGATAACCCAGAAACATGGGGTGTCCTAGGTATGTTTATCTCGACACTGAACCCCCTAGGCTTCTGATGAATCCAGTGATTAGCTAAATTTGACATAGAAAGTAAGAAGGAATGTCTACTTTGTATTGTGGTCCTAATCTAAGATCAGGAGAATCCTGGAATTG

Ensembl | human accession no.

ENSG00000112130

NCBI accession no.

NM_003958

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RNF8(9025) , RNF8(9025)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lu Min et al.
Acta biochimica et biophysica Sinica, 51(8), 791-798 (2019-07-12)
MicroRNAs (miRNAs) are a class of endogenous noncoding genes that regulate gene expression at the posttranscriptional level. In recent decades, miRNAs have been reported to play important roles in tumor growth and metastasis, while some reported functions of a specific
Yoshiyuki Sasaki et al.
International journal of medical sciences, 10(9), 1231-1241 (2013-08-13)
The optimal timing of surgical resection of liver metastasis remains controversial, and guidelines regarding the upper limits of operative indications have not yet been defined. Surgical indication for metastasis from colorectal cancer (CLM) based on results of preoperative chemotherapy and
Justine Sitz et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(39), 19552-19562 (2019-09-11)
High-risk human papillomaviruses (HR-HPVs) promote cervical cancer as well as a subset of anogenital and head and neck cancers. Due to their limited coding capacity, HPVs hijack the host cell's DNA replication and repair machineries to replicate their own genomes.
Shengli Wang et al.
Biochimica et biophysica acta, 1863(6), 1615-1628 (2017-02-22)
The ring finger protein 8 (RNF8), a key component of protein complex crucial for DNA-damage response, consists of a forkhead-associated (FHA) domain and a really interesting new gene (RING) domain that enables it to function as an E3 ubiquitin ligase.
Maoxin Wang et al.
Oncology reports, 34(1), 341-349 (2015-05-09)
Tumor residue or recurrence is common after radiation therapy for nasopharyngeal cancer (NPC) since the tumor cells can repair irradiation-induced DNA damage. The ubiquitination cascade mediates the assembly of repair and signaling proteins at sites of DNA double-strand breaks (DSBs).
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service