Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU028011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC2A1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCACTGTCGTGTCGCTGTTTGTGGTGGAGCGAGCAGGCCGGCGGACCCTGCACCTCATAGGCCTCGCTGGCATGGCGGGTTGTGCCATACTCATGACCATCGCGCTAGCACTGCTGGAGCAGCTACCCTGGATGTCCTATCTGAGCATCGTGGCCATCTTTGGCTTTGTGGCCTTCTTTGAAGTGGGTCCTGGCCCCATCCCATGGTTCATCGTGGCTGAACTCTTCAGCCAGGGTCCACGTCCAGCTGCCATTGCCGTTGCAGGCTTCTCCAACTGGACCTCAAATTTCATTGTGGGCATGTGCTTCCAGTATGTGGAGCAACTGTGTGGTCCCTACGTCTTCATCATCTTCACTGTGCTCCTGGTTCTGTTCTTCATCTTCACCTACTTCAAAGTTCCTGAGACTAAAGGCCGGACCTTCGATGAGATCGCTTCCGGCTTCCGGCAGGGGGGAGCCAGCCAAAGTGACAAGACACCCGAGG

Ensembl | human accession no.

ENSG00000117394

NCBI accession no.

NM_006516

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC2A1(6513) , SLC2A1(6513)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sarka Tumova et al.
Vascular pharmacology, 87, 219-229 (2016-11-09)
Endothelial cells are routinely exposed to elevated glucose concentrations post-prandially in healthy individuals and permanently in patients with metabolic syndrome and diabetes, and so we assessed their sugar transport capabilities in response to high glucose. In human umbilical vein (HUVEC)
Xiaohui Wei et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 54, 120-131 (2019-01-23)
Emerging hallmark of cancer is reprogrammed cellular metabolism, increased glycolytic metabolism is physiological characteristic of human malignant neoplasms. Saponin monomer 13 of the dwarf lilyturf tuber (DT-13) is the main steroidal saponin from Liriopes Radix, which has been reported to
Huanyu Zhao et al.
Journal of Cancer, 10(20), 4989-4997 (2019-10-11)
Background: Glucose transporter 1 (GLUT1) is the main factor of Warburg effect, which is associated with poor prognosis in many tumors. However, the underlying molecular mechanism of GLUT1 in the progression of non-small cell lung cancer (NSCLC) is unclear. Methods:
Li-Fang Shen et al.
OncoTargets and therapy, 13, 11221-11235 (2020-11-12)
The alteration of tumor immunity after radiotherapy (RT) has been widely studied in recent years. However, the mechanism through which RT mediates tumor immunity and the involvement of glycolysis in this mediation in hypopharyngeal cancer remain unclear. This study investigated
Hongshuo Zhang et al.
Frontiers in physiology, 11, 543148-543148 (2020-10-27)
Successful embryo implantation requires receptive endometrium, which is conducive to the process of embryo recognition, adhesion, and invasion within a certain period of time and is inseparable from the dynamic interaction between 17β-estradiol (E2) and progesterone (P4). Proper glucose metabolism
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service