Skip to Content
Merck
All Photos(1)

Documents

EHU000571

Sigma-Aldrich

MISSION® esiRNA

targeting human SOAT1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACGTGCCTCGGGTACTAAATTCAGCTAAGGAGAAATCAAGCACTGTTCCAATACCTACAGTCAACCAGTATTTGTACTTCTTATTTGCTCCTACCCTTATCTACCGTGACAGCTATCCCAGGAATCCCACTGTAAGATGGGGTTATGTCGCTATGAAGTTTGCACAGGTCTTTGGTTGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCCTTGTTTCGGAATATCAAACAGGAGCCCTTCAGCGCTCGTGTTCTGGTCCTATGTGTATTTAACTCCATCTTGCCAGGTGTGCTGATTCTCTTCCTTACTTTTTTTGCCTTTTTGCACTGCTGGCTCAATGCCTTTGCTGAGATGTTACGCTTTGGTGACAGGATGTTCTATAAGGATTGGTGGAACTCCACGTCATACTCCAACTATTATAGAACCTGGAATGTGGTGGTCCATGACTGGCTATATTACTATGCTTACAAGGACTTTCTCTGGTTTTTCTCCAAGAGATTCAAATCTGCTGCCATGTTAGCTGTCTTTGCTGTATCTGCTGTAGTACACGAATATGCCTTGGCTGTTT

Ensembl | human accession no.

ENSG00000057252

NCBI accession no.

NM_003101

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SOAT1(6646) , SOAT1(6646)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhaoe Liu et al.
DNA and cell biology, 35(11), 730-739 (2016-11-01)
Pycnogenol
Yu Xu et al.
Theranostics, 10(24), 11302-11323 (2020-10-13)
Background: Activation of the thermogenic program in white and brown adipocytes presents a promising avenue for increasing energy expenditure during the treatment of obesity. The endogenous mechanism for promoting thermogenesis in brown adipocytes or browning in white adipocytes has indicated
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls
Wataru Amano et al.
The Journal of allergy and clinical immunology, 136(3), 667-677 (2015-06-28)
Barrier disruption and the resulting continuous exposure to allergens are presumed to be responsible for the development of atopic dermatitis (AD). However, the mechanism through which skin barrier function is disrupted in patients with AD remains unclear. Taking into account
Feng Geng et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5337-5348 (2016-11-03)
Elevated lipogenesis regulated by sterol regulatory element-binding protein-1 (SREBP-1), a transcription factor playing a central role in lipid metabolism, is a novel characteristic of glioblastoma (GBM). The aim of this study was to identify effective approaches to suppress GBM growth

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service