Skip to Content
Merck
All Photos(1)

Key Documents

EHU052411

Sigma-Aldrich

MISSION® esiRNA

targeting human HHEX

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATTCTCCAACGACCAGACCATCGAGCTGGAGAAGAAATTCGAGACGCAGAAATATCTCTCTCCGCCCGAGAGGAAGCGTCTGGCCAAGATGCTGCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTTCAGAATCGACGCGCTAAATGGAGGAGACTAAAACAGGAGAACCCTCAAAGCAATAAAAAAGAAGAACTGGAAAGTTTGGACAGTTCCTGTGATCAGAGGCAAGATTTGCCCAGTGAACAGAATAAAGGTGCTTCTTTGGATAGCTCTCAATGTTCGCCCTCCCCTGCCTCCCAGGAAGACCTTGAATCAGAGATTTCAGAGGATTCTGATCAGGAAGTGGACATTGAGGGCGATAAAAGCTATTTTAATGCTGGATGATGACCACTGGCATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

R M Kershaw et al.
Oncogenesis, 6(6), e346-e346 (2017-06-13)
Breast tumours progress from hyperplasia to ductal carcinoma in situ (DCIS) and invasive breast carcinoma (IBC). PRH/HHEX (proline-rich homeodomain/haematopoietically expressed homeobox) is a transcription factor that displays both tumour suppressor and oncogenic activity in different disease contexts; however, the role
Eudmar Marcolino et al.
Oncogenesis, 9(2), 10-10 (2020-02-06)
Cancer cells go through a process known as epithelial-mesenchymal transition (EMT) during which they acquire the ability to migrate and invade extracellular matrix. Some cells also acquire the ability to move across a layer of endothelial cells to enter and
Philip Kitchen et al.
Cancer research, 80(4), 757-770 (2019-12-18)
Aberrant Notch and Wnt signaling are known drivers of cholangiocarcinoma (CCA), but the underlying factors that initiate and maintain these pathways are not known. Here, we show that the proline-rich homeodomain protein/hematopoietically expressed homeobox (PRH/HHEX) transcription factor forms a positive

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service