Skip to Content
Merck
All Photos(1)

Documents

EHU131511

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA10

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAATTCCAAAGGTGAAAACGCAGCCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAGCACCAGACACTGGAGCTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAGAGATTAGCCGCAGCGTCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAACTGAAGAAAATGAATCGAGAAAACCGGATCCGGGAGCTCACAGCCAACTTTAATTTTTCCTGATGAATCTCCAGGCGACGCGGTTTTTTCACTTCCCGAGCGCTGGTCCCCTCCCTCTGTCTTCAGGCTCTGCCCAGGAACTCGCACCTGTGCTGGAGCCCTGTTCCTCCCTCCCACACTCGCCATCTCCTGGGCCGTTACATCTGTGCAGGGCTGGTTTGTTCTGACTTTTTGTTTCTTTGTGTTTGCTTGGTGC

Ensembl | human accession no.

ENSG00000153807

NCBI accession no.

NM_018951

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HOXA10(3206) , HOXA10(3206)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Wang et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(6), 839-846 (2018-12-14)
Endometrial receptivity is a critical factor for embryo implantation. A decrease in endometrial homeobox A10 (HOXA10) expression is associated with hypermethylation of its promoter and lower endometrial receptivity in animals and humans. 5-Aza-2'-deoxycytidine (AZA) is a DNA methyltransferase inhibitor. However
Xian-Ping Cui et al.
Digestive diseases and sciences, 59(7), 1442-1451 (2014-01-28)
HOXA10 is closely related to tumor progression in many human cancers. However, the role of HOXA10 in pancreatic cancer remains unclear. The aim of this study was to determine the involvement of HOXA10 in pancreatic cancer cell invasion and migration.
L Zhang et al.
Reproduction in domestic animals = Zuchthygiene, 52(6), 1081-1092 (2017-08-02)
Proper HOXA10 expression was essential for endometrial receptivity what was crucial for successful embryo implantation in mammalian. This study confirmed that miR-182 regulated the expression levels of HOXA10 by binding to its 3' UTR, selectively downregulated HOXA10 in goat endometrial
Zhi Long et al.
Endocrine-related cancer, 26(3), 279-292 (2019-01-23)
Homeobox A10 (HOXA10) is an important transcription factor that regulates the development of the prostate gland. However, it remains unknown whether it modulates prostate cancer (PCa) progression into castrate-resistant stages. In this study, we have applied RNA in situ hybridization

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service