Skip to Content
Merck
All Photos(1)

Documents

EHU116541

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK3, C8ORF44-SGK3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTATTGCCGAGATGTTGCTGAAATGTATGACAATATCCTTCACAAACCCCTAAGTTTGAGGCCAGGAGTGAGTCTTACAGCCTGGTCCATTCTGGAAGAACTCCTAGAAAAAGACAGGCAAAATCGACTTGGTGCCAAGGAAGACTTTCTTGAAATTCAGAATCATCCTTTTTTTGAATCACTCAGCTGGGCTGACCTTGTACAAAAGAAGATTCCACCACCATTTAATCCTAATGTGGCTGGACCAGATGATATCAGAAACTTTGACACAGCATTTACAGAAGAAACAGTTCCATATTCTGTGTGTGTATCTTCTGACTATTCTATAGTGAATGCCAGTGTATTGGAGGCAGATGATGCATTCGTTGGTTTCTCTTATGCACCTCCTTCAGAAGACTTATTTTTGTGAGCAGTTTGCCATTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuanzhong Wang et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(8), E1500-E1508 (2017-02-09)
Many estrogen receptor alpha (ERα)-positive breast cancers initially respond to aromatase inhibitors (AIs), but eventually acquire resistance. Here, we report that serum- and glucocorticoid-inducible kinase 3 (SGK3), a kinase transcriptionally regulated by ERα in breast cancer, sustains ERα signaling and
Laura Creevey et al.
Molecular cancer therapeutics, 18(10), 1731-1743 (2019-07-11)
Divergent roles for androgen receptor (AR) in breast cancer have been reported. Following aromatase inhibitor (AI) treatment, the conversion of circulating androgens into estrogens can be diminished by >99%. We wished to establish whether the steroid environment can dictate the
Shingo Miyata et al.
Biochemical and biophysical research communications, 464(1), 76-82 (2015-06-06)
Major depression, one of the most prevalent mental illnesses, is thought to be a multifactorial disease related to both genetic and environmental factors. However, the genes responsible for and the pathogenesis of major depression at the molecular level remain unclear.
Huailei Liu et al.
Journal of neuro-oncology, 122(3), 431-439 (2015-02-28)
Glioblastoma multiforme (GBM) is the most malignant brain tumor in humans. Previous studies have demonstrated that microRNA plays important roles in the development and proliferation of GBM cells. Here we defined the mechanism by which miR-212-3p regulated the proliferation of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service