Skip to Content
Merck
All Photos(1)

Documents

EMU177661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Insr

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGCAGATCCTCCTGATGTTCAAGACCAGACCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACAGATTACCTGCTTCTCTTCCGTGTCTATGGTCTGGAAAGTCTGAAAGACCTCTTCCCAAATCTCACAGTCATCCGAGGCTCCCGTCTCTTCTTCAACTATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATGAACATCACCCGGGGCTCTGTCCGCATCGAGAAGAATAATGAGCTCTGCTACCTGGCCACTATCGACTGGTCCCGTATCCTGGATTCTGTGGAGGACAACTACATTGTACTGAACAAAGATGACAACGAGGAATGTGGGGATGTCTGTCCAGGCACCGCCAAGGGCAAGACCAACTGTCCTGCCACTGTCATCAATGGGCAGTTTGTGGAACGGTGCTGGACACACAGTCATTGTCAGAAAGTTTGCCCAACCATCTGTAAGTCACATGGCTGCACAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Ingrit Hamann et al.
Archives of biochemistry and biophysics, 558, 42-50 (2014-06-17)
Copper ions are known to induce insulin-like effects in various cell lines, stimulating the phosphoinositide 3'-kinase (PI3K)/Akt signaling cascade and leading to the phosphorylation of downstream targets, including FoxO transcription factors. The aim of this work was to study the
Isabel Heidegger et al.
Oncotarget, 5(9), 2723-2735 (2014-05-09)
We scrutinized the effect of insulin receptor (INSR) in addition to IGF1R in PCa using in vitro and in vivo models. In-vitro overexpression of IGF1R and INSRA, but not INSRB increased cell proliferation, colony formation, migration, invasion and resistance to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service