Skip to Content
Merck
All Photos(1)

Key Documents

EHU150721

Sigma-Aldrich

MISSION® esiRNA

targeting human RUVBL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTGCATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATGGGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAATAAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTTGTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAGTCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGCACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

O Breig et al.
Leukemia, 28(6), 1271-1279 (2013-12-18)
The oncogenic fusion protein AML1-ETO, also known as RUNX1-RUNX1T1 is generated by the t(8;21)(q22;q22) translocation, one of the most frequent chromosomal rearrangements in acute myeloid leukemia (AML). Identifying the genes that cooperate with or are required for the oncogenic activity
Fabian Zimmermann et al.
Science advances, 6(51) (2020-12-24)
The microtubule nucleator γ-tubulin ring complex (γTuRC) is essential for the function of microtubule organizing centers such as the centrosome. Since its discovery over two decades ago, γTuRC has evaded in vitro reconstitution and thus detailed structure-function studies. Here, we
M Jane Morwitzer et al.
Viruses, 11(4) (2019-04-26)
Ebola virus (EBOV) is a filovirus that has become a global public health threat in recent years. EBOV is the causative agent of a severe, often fatal hemorrhagic fever. A productive viral infection relies on the successful recruitment of host

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service