Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU016971

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTC

Ensembl | human accession no.

ENSG00000087245

NCBI accession no.

NM_004530

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MMP2(4313) , MMP2(4313)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yonghao Gu et al.
Ophthalmic research, 55(2), 70-75 (2015-11-28)
Proliferative retinal angiogenesis may severely impair the retina. Previous studies have indicated that matrix metalloproteinase (MMP)-2 and MMP-9 play important roles in the process of retinal angiogenesis. In this study, we suppressed MMP-2 and MMP-9 expression with RNA interference (RNAi)
Huaping Zhao et al.
Life sciences, 256, 117897-117897 (2020-06-06)
Glioma is the most common brain malignancy and surgical resection is the primary option for patient with glioma. Anesthetics could be used to inhibit cancer dissemination and metastasis during surgery. This study aims to assess the function of volatile anesthetic
Xi Cheng et al.
Scientific reports, 7(1), 12362-12362 (2017-09-30)
Studies indicate that the chemokine receptor is responsible for poor prognosis of hepatocellular carcinoma (HCC) patients. In this study, we initially demonstrated that CCR4 is overexpressed in HCC specimens, and its elevation in HCC tissues positively correlates with tumor capsule
Qiong Pan et al.
Placenta, 53, 48-53 (2017-05-11)
Preeclampsia (PE) is a serious pregnancy-related syndrome, which is characterized by gestational hypertension and proteinuria. The microRNA-93 (miR-93) is upregulated in the maternal plasma of patients with PE. However, the functional role of miR-93 in PE remains unknown. Here, we
Yan Liu et al.
Molecular medicine reports, 23(5) (2021-03-25)
Age-related cataract (ARC) is the primary cause of blindness worldwide. Abnormal expression of microRNAs (miRNAs/miRs) has been reported to be associated with multiple diseases, including ARC. However, the potential role of miR-124 in ARC remains unclear. The present study used
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service