Skip to Content
Merck
All Photos(1)

Documents

EMU069661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Becn1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAATAAGATGGGTCTGAAGTTTCAGAGGTACCGACTTGTTCCCTATGGAAATCATTCCTATCTGGAGTCTCTGACAGACAAATCTAAGGAGTTGCCGTTATACTGTTCTGGGGGTTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTAGCTTTTCTGGACTGTGTGCAGCAGTTCAAAGAAGAGGTGGAAAAAGGAGAGACTCGATTTTGTCTTCCGTACAGGATGGACGTGGAGAAAGGCAAGATTGAAGACACTGGAGGCAGTGGCGGCTCCTATTCCATCAAAACCCAGTTTAACTCGGAGGAGCAGTGGACAAAAGCGCTCAAGTTCATGCTGACCAATCTCAAGTGGGGTCTTGCCTGGGTGTCCTCACAGTTCTATAACAAGTGACTTGCTCCTTAGGGGATGTTTG

Ensembl | mouse accession no.

ENSMUSG00000035086

NCBI accession no.

NM_019584

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... BECN1(56208) , Becn1(56208)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ge Niu et al.
The Journal of biological chemistry, 290(29), 18102-18110 (2015-06-10)
One of the fundamental functions of molecular chaperone proteins is to selectively conjugate cellular proteins, targeting them directly to lysosome. Some of chaperones, such as the stress-induced Hsp70, also play important roles in autophagosome-forming macroautophagy under various stress conditions. However
Yusra Al Dhaheri et al.
PloS one, 9(10), e109630-e109630 (2014-10-10)
In this study we investigated the in vitro and in vivo anticancer effect of carnosol, a naturally occurring polyphenol, in triple negative breast cancer. We found that carnosol significantly inhibited the viability and colony growth induced G2 arrest in the
Xing-guo Zhao et al.
PloS one, 10(4), e0126147-e0126147 (2015-04-30)
Hypopharyngeal squamous cell carcinoma (HSCC) has the worst prognosis among head and neck cancers. Cisplatin (DDP)-based chemotherapy is an important part of multimodal treatments. However, resistance to DDP severely impairs the effectiveness of chemotherapy for HSCC. Chloroquine (CQ) has been
Tiina Öhman et al.
Journal of immunology (Baltimore, Md. : 1950), 192(12), 5952-5962 (2014-05-09)
Dectin-1 is a membrane-bound pattern recognition receptor for β-glucans, which are the main constituents of fungal cell walls. Detection of β-glucans by dectin-1 triggers an effective innate immune response. In this study, we have used a systems biology approach to
Pujika Emani Munasinghe et al.
International journal of cardiology, 202, 13-20 (2015-09-20)
Diabetes promotes progressive loss of cardiac cells, which are replaced by a fibrotic matrix, resulting in the loss of cardiac function. In the current study we sought to identify if excessive autophagy plays a major role in inducing this progressive
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service