Skip to Content
Merck
All Photos(1)

Documents

EHU106621

Sigma-Aldrich

MISSION® esiRNA

targeting human SUMO1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGC

Ensembl | human accession no.

ENSG00000116030

NCBI accession no.

NM_003352

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SUMO1(7341) , SUMO1(7341)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yufeng Yao et al.
Pulmonary pharmacology & therapeutics, 55, 38-49 (2019-02-01)
Pulmonary arterial hypertension (PAH) is a life-threatening disease without effective therapies. PAH is associated with a progressive increase in pulmonary vascular resistance and irreversible pulmonary vascular remodeling. SUMO1 (small ubiquitin-related modifier 1) can bind to target proteins and lead to
Dao-Ying Yuan et al.
Oncology reports, 38(4), 2360-2368 (2017-08-10)
Radiotherapy is one of the most effective non-surgical treatments for oral squamous cell carcinoma. However, radioresistance remains a major impediment to radiotherapy. Although BetA (Betulinic acid) can induce radiosensitization, the underlying mechanism and whether it could induce radiosensitization in oral
Sabine Hergovits et al.
Journal of cellular and molecular medicine, 21(11), 3087-3099 (2017-06-01)
Interleukin (IL)-6-type cytokines have no direct antiviral activity; nevertheless, they display immune-modulatory functions. Oncostatin M (OSM), a member of the IL-6 family, has recently been shown to induce a distinct number of classical interferon stimulated genes (ISG). Most of them
Lin-Nan Zhu et al.
Frontiers in cellular neuroscience, 12, 262-262 (2018-09-11)
Methamphetamine (METH) is an illegal and widely abused psychoactive stimulant. METH abusers are at high risk of neurodegenerative disorders, including Parkinson's disease (PD). Previous studies have demonstrated that METH causes alpha-synuclein (α-syn) aggregation in the both laboratory animal and human.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service