Skip to Content
Merck
All Photos(1)

Key Documents

EHU116361

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCCCAGAGCATCATTGACGCAAATGATACTTTGAAGGACTTGACGAAAGTAACATTGGGAGACAATGTGAAATACTACAATTTGGCCAGGATAAAGTGGGACCCCTCTGATCCTCAAATAATATCTGAAGGTCTTTATGCAATTGCTGTAGTTTTAAGTTTCTCTAGGATAGCTTATATTTTACCAGCAAATGAAAGCTTTGGACCTCTGCAGATATCACTTGGAAGAACAGTCAAAGACATCTTCAAGTTCATGGTCATATTCATTATGGTGTTTGTGGCCTTTATGATTGGAATGTTCAATCTCTACTCCTACTACATTGGTGCAAAACAAAATGAAGCCTTCACAACAGTTGAAGAGAGTTTTAAGACACTGTTCTGGGCTATATTTGGACTTTCTGAAGTGAAATCAGTGGTCATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Yang et al.
Cell biochemistry and function, 38(4), 384-391 (2019-12-31)
Acute kidney injury (AKI) is a common adverse reaction of the anticancer drug. Among these chemotherapeutic agents, cisplatin, an effective chemotherapeutic drug, is extensively applied to the treatment of solid tumours, yet various adverse reactions, especially AKI, often limit their
Liang Wen et al.
Scientific reports, 6, 23269-23269 (2016-03-25)
Hepatocellular carcinoma (HCC) is notoriously refractory to chemotherapy because of its tendency to develop multi-drug resistance (MDR), whose various underlying mechanisms make it difficult to target. The calcium signalling pathway is associated with many cellular biological activities, and is also
Haiyang Tang et al.
American journal of physiology. Lung cellular and molecular physiology, 310(9), L846-L859 (2016-03-13)
An increase in cytosolic free Ca(2+) concentration ([Ca(2+)]cyt) in pulmonary arterial smooth muscle cells (PASMC) is a major trigger for pulmonary vasoconstriction and a critical stimulation for PASMC proliferation and migration. Previously, we demonstrated that expression and function of calcium
Navin K Kapur et al.
Journal of the American Heart Association, 3(4) (2014-07-13)
Right ventricular (RV) failure is a major cause of mortality worldwide and is often a consequence of RV pressure overload (RVPO). Endoglin is a coreceptor for the profibrogenic cytokine, transforming growth factor beta 1 (TGF-β1). TGF-β1 signaling by the canonical
Mingming Ma et al.
Frontiers in pharmacology, 10, 1668-1668 (2020-03-03)
High glucose (HG) increases the production of reactive oxygen species (ROS), leading to decreased glutamate uptake in Müller cells. The transient receptor potential cation channel 6 (TRPC6) channel, an oxidative stress-sensitive Ca2+-permeable cationic channel, is readily detected in Müller cells

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service