Skip to Content
Merck
All Photos(1)

Key Documents

EHU082281

Sigma-Aldrich

MISSION® esiRNA

targeting human TEK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAATTTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGAAGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTGCTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAGGCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCTCAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCAGCTGTGATTTCTTGGACAATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAATGAAGACCAGCACGTTGATGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Adam C Mirando et al.
JCI insight, 4(4) (2019-01-23)
The angiopoietin (Ang)/Tie2 signaling pathway is essential for maintaining vascular homeostasis, and its dysregulation is associated with several diseases. Interactions between Tie2 and α5β1 integrin have emerged as part of this control; however, the mechanism is incompletely understood. AXT107, a
Kaihong Zeng et al.
Molecular and cellular biochemistry, 396(1-2), 239-248 (2014-07-26)
Previously, we confirmed that taurine prevented diabetes-induced apoptosis in retinal glial cells via its anti-oxidation and anti-glutamate excitotoxicity mechanisms. The aim of this study is to investigate the effects of taurine on angiopoietin-2 (Ang-2)/Tie-2 system expressions and apoptosis in high
Martin Teichert et al.
Nature communications, 8, 16106-16106 (2017-07-19)
The Tie receptors with their Angiopoietin ligands act as regulators of angiogenesis and vessel maturation. Tie2 exerts its functions through its supposed endothelial-specific expression. Yet, Tie2 is also expressed at lower levels by pericytes and it has not been unravelled

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service