Skip to Content
Merck
All Photos(1)

Documents

EHU077721

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGAGCAAATGGCCTACCTCCAACAGAAAGAGCTGGACCTGATAGATTATAAATTTGGAGAACGTAAAAAAGATGGTGATCCAGATTCCCAGGAACAACAGTTACTGGATTTCTCTGAACCCGACTGTCCCTCTTCATCTGCAAACAGTAGAAAAGACAAGTCTCTGAGAATTATGAGCCAGAAGTTTGTCATGCTGTTCCTCGTCTCCAAAACCAAGATTGTCACTCTGGATGTGGCTGCCAAAATACTGATAGAAGAAAGCCAAGATGCCCCAGACCATAGTAAATTTAAAACAAAGGTACGACGCCTCTATGACATAGCCAATGTTCTGACCAGCTTGGCTCTGATAAAGAAAGTGCATGTAACAGAAGAGCGAGGTCGTAAACCAGCCTTCAAGTGGATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rui Yang et al.
British journal of cancer, 123(9), 1445-1455 (2020-08-21)
E2F transcription factors are considered to be important drivers of tumour growth. E2F7 is an atypical E2F factor, and its role in glioblastoma remains undefined. E2F7 expression was examined in patients by IHC and qRT-PCR. The overall survival probability was
Weihong Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 94-101 (2018-05-18)
Colorectal cancer (CRC) is one of the most common malignancies with high morbidity and mortality rates worldwide. This study aimed to investigate whether miR-3666 was involved in inhibitory effects of all-transretinoic acid (ATRA) on the development of colorectal cancer (CRC).
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service