Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU006781

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gja1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAACATCAAGCTGCCAATCGATTGTGGAGGAGAAAAAAAAGGGTGCTTGCAGAACGTGCACCTGGGGTGTTCATTTCGTTCCCGTGGAGGTGGTACTCAACAACCTCAGTAATGAGGCGTAGAAAACAAAGACATTACAATATCTAGGTTCCTTGGGGGGTGTTTTGGGATAGCTAGGCGGCAAAAGTAGGGAAAGGGGAGGTATGTAACGGTATTTAATGTAGAAGATTCAAAGAGCTTAAATTCTAGTAAGAGTCTCATTGGATGAAACATAGATAGGGCTTTCTCTCTCTGCCCCCCAACTGAACCTTAAGAATGGTTCTGTATACATGAGTGAGTGGGTGATATATATTTTTTTTAATTTTTGTTTTACTGAGATTCTGCCATAGAGCTTTGAGCAGGAATCCAAG

Ensembl | mouse accession no.

ENSMUSG00000050953

NCBI accession no.

NM_010288

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... GJA1(14609) , Gja1(14609)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Tobias Forster et al.
Oncotarget, 5(6), 1621-1634 (2014-04-20)
The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and
Dominique Thuringer et al.
Oncotarget, 6(12), 10267-10283 (2015-04-15)
High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not
Lingzhi Wang et al.
Oncology reports, 34(4), 2133-2141 (2015-08-12)
Cisplatin, an important chemotherapeutic agent against testicular germ cell cancer, induces testicular toxicity on Leydig and Sertoli cells, leading to serious side-effects such as azoospermia and infertility. In a previous study, it was found that simvastatin enhanced the sensitivity of
S Morel et al.
Thrombosis and haemostasis, 112(2), 390-401 (2014-05-16)
Ubiquitous reduction of the gap junction protein Connexin43 (Cx43) in mice provides beneficial effects on progression and composition of atherosclerotic lesions. Cx43 is expressed in multiple atheroma-associated cells but its function in each cell type is not known. To examine
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service