Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU158861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cblb

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCCAAGCTTCAGTTGAAAAACAGCCCACCGTATATACTTGATATTTTACCTGATACGTATCAGCACTTGAGACTTATATTGAGTAAATATGATGACAACCAGAAGCTGGCTCAACTGAGCGAGAATGAGTACTTTAAAATCTACATCGATAGTCTCATGAAGAAGTCGAAGCGAGCGATCCGGCTCTTTAAAGAAGGCAAGGAAAGGATGTACGAAGAGCAGTCGCAGGACAGACGGAATCTCACAAAGCTGTCCCTTATCTTCAGTCACATGCTGGCAGAAATCAAGGCGATCTTTCCCAATGGCCAGTTCCAGGGAGATAACTTCCGGATCACCAAAGCAGATGCTGCTGAGTTCTGGAGGAAGTTTTTTGGAGACAAAACTATTGTACCATGGAAAGTCTTCAGACAGTGCCTGCATGAGGTCCATCAGATCAGCTCTGGCCTGGAAGCAATGGCTCTGAAGTCAACCATTGATTTAACTTGCAATGATTACATCTCAGTGTTTGAATTTG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
Wei-Xia Yang et al.
FEBS letters, 589(15), 1975-1980 (2015-06-27)
Orosomucoid 1-Like Protein 3 (ORMDL3) is an asthma candidate gene and Casitas B lineage lymphoma b (Cbl-b), an E3 ubiquitin ligase, is a critical factor in maintaining airway immune tolerance. However, the association of Cbl-b with ORMDL3 for asthma is
Yubo Cao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5607-5615 (2015-02-24)
Mammalian target of rapamycin (mTOR) has emerged as a new potential therapeutic target for gastric cancer. However, a phase III clinical trial found that monotherapy with the mTOR inhibitor everolimus did not significantly improve the overall survival of patients with

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej