Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EMU076311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rela

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCATGTCTCACTCCACAGCTGAGCCCATGCTGATGGAGTACCCTGAAGCTATAACTCGCCTGGTGACAGGGTCCCAGAGGCCCCCTGACCCAGCTCCCACACCCCTGGGGACCTCGGGGCTTCCCAATGGTCTCTCCGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCTCTGCTCTTTTGAGTCAGATCAGCTCCTAAGGTGCTGACAGCGACCCTGCTCAGAGCACCAGGTTTCAGGGCACTGAAGCCTTCCCGAAGTGCGTACACATTCTGGGGAGTGTGCTCCAGCTGCCCCCGACTTGTTTGGGTGATCTCTCTGGGGCGGCACGTTTTACTCTTTATCTCGCTTTCGGAGGTGCTTTCGCAGGAGCATTAACCTCCTGGAGACGGAGCTGGGAGGACTCGGTGCATCCCTGTGTTGATAGCTCCTGCTTCGG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000024927

numer dostępu NCBI

NM_009045

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... RELA(19697) , Rela(19697)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

12 - Non Combustible Liquids

Klasa zagrożenia wodnego (WGK)

WGK 1

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yun Qu et al.
Cell biochemistry and function, 33(5), 320-325 (2015-07-17)
Nuclear factor-kappaB (NF-κB) is an important transcriptional factor and regulates a variety of pathophysiologic process involved in cell survival and death. This study aimed to assess the effects of NF-κB p65 subunit knockdown in suppression of nude mouse lung tumour
Martyn K White et al.
PloS one, 9(10), e110122-e110122 (2014-10-14)
The human neurotropic polyomavirus JC (JCV) causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under
W Zhang et al.
European review for medical and pharmacological sciences, 18(9), 1361-1367 (2014-05-29)
S100A4 is a member of the S100 family of calcium-binding proteins, which possesses a wide range of biological functions, such as regulation of angiogenesis, cell survival, motility, and invasion. Here, we demonstrate for the first time a major role of
Maroof Alam et al.
Oncotarget, 5(9), 2622-2634 (2014-04-29)
The capacity of breast cancer cells to form mammospheres in non-adherent serum-free culture is used as a functional characteristic of the self-renewing stem-like cell population. The present studies demonstrate that silencing expression of the MUC1-C oncoprotein inhibits growth of luminal
Junxiu Liu et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 30(6), 461-465 (2014-03-22)
Vascular endothelial growth factor C (VEGF-C) promotes cervical cancer metastasis, while the detailed mechanism remains obscure. Recent evidence shows that galectin-3 (Gal-3), a glycan binding protein, interacts with the VEGF receptors and reinforces their signal transduction. In this study, we
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej