Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EMU021961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk14

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGAGTGGAAGAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAAATGGAGTCCTGAGCACCTGGTTTCTGTTCTGTCTATCTCACTTCACTGTGAGGGGAAGACCTTCTCATGGGAACTCTCCAAATACCATTCAAGTGCCTCTTGTTGAAAGATTCCTTCATGGTGGAAGGGGGTGCATGTATGTGTTAGTGTTTGTGTGTGTGTGTGTGTCTGTCTGTTCGTCTGTCCACCTATCTTTGTGGAAGTCACTGTGATGGTAGTGACTTTATGAGTTGTGAATGGTCCTTGGCAGTCTGCCTGCTTTCTCAGAGTCTGGGCAGGCCGATGGGAACTGTCATCTCCTTAGGGATGTGTGTGTTCAGTGCAAAGTAAGAAATATGAAAATATCCCTGTTCTTAGTTACCTTGCCACTTTGGCTTC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000053436

numer dostępu NCBI

NM_011951

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... MAPK14(26416) , Mapk14(26416)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hye Jeong Lee et al.
Molecular endocrinology (Baltimore, Md.), 29(6), 873-881 (2015-04-01)
Irisin is a novel myokine produced by skeletal muscle. However, its metabolic role is poorly understood. In the present study, irisin induced glucose uptake in differentiated skeletal muscle cells. It increased AMP-activated protein kinase (AMPK) phosphorylation and the inhibition of
Ana M Tormos et al.
PloS one, 12(2), e0171738-e0171738 (2017-02-07)
Hepatocyte poliploidization is an age-dependent process, being cytokinesis failure the main mechanism of polyploid hepatocyte formation. Our aim was to study the role of p38α MAPK in the regulation of actin cytoskeleton and cytokinesis in hepatocytes during development and aging.
Xiaoling Gu et al.
Free radical biology & medicine, 83, 149-158 (2015-03-17)
An increasing number of studies have focused on the phenomenon that mitochondrial DNA (mtDNA) activates innate immunity responses. However, the specific role of mtDNA in inflammatory lung disease remains elusive. This study was designed to examine the proinflammatory effects of
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej